p53-ABAI

p53-ABAI

Search name

p53-ABAI,Plasmid p53-ABAI,p53-ABAI vector

p53-ABAI Information

Promoter: URA3
Replicon: pUC ori
Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids
Plasmid size: 4944bp
Prokaryotic resistance: ampicillin Amp (100 u g/ml)
Screening markers: URA3
Cloned strains of Escherichia coli, DH5 A and other Escherichia coli
Culture conditions: 37 centigrade, aerobic LB
Expression host: Y1Hgold and other yeast
Culture conditions: 30 centigrade, YPDA, aerobic
5'sequencing primers: pABAI-F (GTTCCTTATATGTAGCTTTCGACA)
3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC)
Remarks: low copy plasmids
Use: Yeast expression

p53-ABAI Description

p53-ABAI  is a single hybrid yeast positive control plasmid. The plasmid has AbA resistance and thus has a strong screening ability, which can greatly reduce the background level.

p53-AbAi is a yeast reporter vector that serves as a positive control in the Matchmaker Gold Yeast One-Hybrid Library Screening System. The vector contains a p53 binding site, located upstream of the yeast iso-1-cytochrome C minimal promoter and the AUR1-C gene, an antibiotic resistance gene that confers resistance to Aureobasidin A. Expression of AUR1-C, and thus AbA resistance, is induced by the binding of GAL4 activation domain-p53 fusion proteins to the p53 binding site upstream of AUR1-C.
      p53-AbAi cannot be propagated episomally in yeast; it can only be stably maintained through integration into the host genome. Integration is accomplished via homologous recombination between the vector’s URA3 gene and the nonfunctional ura3-52 locus of the yeast strain provided in the Matchmaker Gold Yeast One-Hybrid System. URA3 is a nutritional marker that can also be used for the selection of recombinant yeast. To allow propagation and selection in E. coli, the vector also contains a Col E1 origin of replication and an ampicillin resistance gene (Ampr).
     p53-AbAi is a positive control reporter vector that is designed to be used in conjunction with the autonomously replicating pGADT7-Rec vector and the p53 control cDNA provided in the Matchmaker Gold Yeast One-Hybrid Library Screening System. To perform control reactions, first linearize the p53-AbAi vector with BstBI, transform the vector into competent yeast cells, and select for integrants on SD/–Ura medium. Next, cotransform the p53 control cDNA and the SmaI-linearized pGADT7-Rec vector (provided) into competent yeast cells, and select for recombinants on SD/–Leu medium containing AbA (see the protocol in the Matchmaker Gold Yeast One-Hybrid Library Screening System User Manual  for details).
     Transformation of yeast with the linearized p53-AbAi vector will result in the integration of the vector into the yeast chromosome. Subsequent cotransformation of the linearized pGADT7-Rec vector and the p53 control cDNA will yield a construct, through the gap-repair method,that will constitutively express a GAL4 AD-p53 fusion protein. GAL4 AD-p53 will interact with the p53 binding sites on p53-AbAi and stimulate transcription of AUR1-C.
       •    Suitable host strains: DH5α and other general purpose strains.
       •    Selectable marker: plasmid confers resistance to ampicillin (100 µg/ml) to E. coli hosts.
       •    E. coli replication origin: ColE1
       •    Copy number: low

p53-ABAI Sequence