p53-ABAI
Search name
p53-ABAI,Plasmid p53-ABAI,p53-ABAI vector
p53-ABAI Information
Promoter: URA3
Replicon: pUC ori
Plasmid classification: yeast series plasmids; yeast hybrid plasmids; single hybrid plasmids
Plasmid size: 4944bp
Prokaryotic resistance: ampicillin Amp (100 u g/ml)
Screening markers: URA3
Cloned strains of Escherichia coli, DH5 A and other Escherichia coli
Culture conditions: 37 centigrade, aerobic LB
Expression host: Y1Hgold and other yeast
Culture conditions: 30 centigrade, YPDA, aerobic
5'sequencing primers: pABAI-F (GTTCCTTATATGTAGCTTTCGACA)
3'sequencing primers: pABAI-R (CCATCTCGAAAAAGGGTTTGCC)
Remarks: low copy plasmids
Use: Yeast expression
p53-ABAI Description
p53-ABAI is a single hybrid yeast positive control plasmid. The plasmid has AbA resistance and thus has a strong screening ability, which can greatly reduce the background level.
p53-AbAi is a yeast reporter vector that serves as a positive control in the Matchmaker Gold Yeast One-Hybrid Library Screening System. The vector contains a p53 binding site, located upstream of the yeast iso-1-cytochrome C minimal promoter and the AUR1-C gene, an antibiotic resistance gene that confers resistance to Aureobasidin A. Expression of AUR1-C, and thus AbA resistance, is induced by the binding of GAL4 activation domain-p53 fusion proteins to the p53 binding site upstream of AUR1-C.
p53-AbAi cannot be propagated episomally in yeast; it can only be stably maintained through integration into the host genome. Integration is accomplished via homologous recombination between the vector’s URA3 gene and the nonfunctional ura3-52 locus of the yeast strain provided in the Matchmaker Gold Yeast One-Hybrid System. URA3 is a nutritional marker that can also be used for the selection of recombinant yeast. To allow propagation and selection in E. coli, the vector also contains a Col E1 origin of replication and an ampicillin resistance gene (Ampr).
p53-AbAi is a positive control reporter vector that is designed to be used in conjunction with the autonomously replicating pGADT7-Rec vector and the p53 control cDNA provided in the Matchmaker Gold Yeast One-Hybrid Library Screening System. To perform control reactions, first linearize the p53-AbAi vector with BstBI, transform the vector into competent yeast cells, and select for integrants on SD/–Ura medium. Next, cotransform the p53 control cDNA and the SmaI-linearized pGADT7-Rec vector (provided) into competent yeast cells, and select for recombinants on SD/–Leu medium containing AbA (see the protocol in the Matchmaker Gold Yeast One-Hybrid Library Screening System User Manual for details).
Transformation of yeast with the linearized p53-AbAi vector will result in the integration of the vector into the yeast chromosome. Subsequent cotransformation of the linearized pGADT7-Rec vector and the p53 control cDNA will yield a construct, through the gap-repair method,that will constitutively express a GAL4 AD-p53 fusion protein. GAL4 AD-p53 will interact with the p53 binding sites on p53-AbAi and stimulate transcription of AUR1-C.
• Suitable host strains: DH5α and other general purpose strains.
• Selectable marker: plasmid confers resistance to ampicillin (100 µg/ml) to E. coli hosts.
• E. coli replication origin: ColE1
• Copy number: low
p53-ABAI Sequence
LOCUS Exported 4944 bp ds-DNA circular SYN 10-SEP-2016
DEFINITION synthetic circular DNA
KEYWORDS p53-AbAi
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 4944)
TITLE Direct Submission
JOURNAL Exported Saturday, September 10, 2016
COMMENT Created by Clontech Laboratories Inc. http://www.clontech.com
Cat. No. 630491
FEATURES Location/Qualifiers
source 1..4944
/organism="synthetic DNA construct"
/mol_type="other DNA"
promoter 25..83
/note="p53 binding site"
misc_feature 235..1440
/note="Aur1-C"
/note="Aureobasidin Resistance"
rep_origin 2209..2659
/note="pUC origin"
misc_feature complement(2856..3716)
/note="Amp(R)"
misc_feature complement(3925..4727)
/note="URA3"
ORIGIN
1 aagcttgaat tcgagctcgg taccaggcat gcctagcatg cctaggcatg cctaggcatg
61 cctaggcatg cctaggcatg cctggatccc tcgaggcatg tgctctgtat gtatataaaa
121 ctcttgtttt cttcttttct ctaaatattc tttccttata cattaggtcc tttgtagcat
181 aaattactat acttctatag acacgcaaac acaaatacac acactaaatt aataatggca
241 aacccttttt cgagatggtt tctatcagag agacctccaa actgccatgt agccgattta
301 gaaacaagtt tagatcccca tcaaacgttg ttgaaggtgc aaaaatacaa acccgcttta
361 agcgactggg tgcattacat cttcttggga tccatcatgc tgtttgtgtt cattactaat
421 cccgcacctt ggatcttcaa gatccttttt tattgtttct tgggcacttt attcatcatt
481 ccagctacgt cacagttttt cttcaatgcc ttgcccatcc taacatgggt ggcgctgtat
541 ttcacttcat cgtactttcc agatgaccgc aggcctccta ttactgtcaa agtgttacca
601 gcggtggaaa caattttata cggcgacaat ttaagtgata ttcttgcaac atcgacgaat
661 tcctttttgg acattttagc atggttaccg tacggactat ttcattatgg ggccccattt
721 gtcgttgctg ccatcttatt cgtatttggt ccaccaactg ttttgcaagg ttatgctttt
781 gcatttggtt atatgaacct gtttggtgtt atcatgcaaa atgtctttcc agccgctccc
841 ccatggtata aaattctcta tggattgcaa tcagccaact atgatatgca tggctcgcct
901 ggtggattag ctagaattga taagctactc ggtattaata tgtatactac atgtttttca
961 aattcctccg tcattttcgg tgcttttcct tcactgcatt ccgggtgtgc tactatggaa
1021 gccctgtttt tctgttattg ttttccaaaa ttgaagccct tgtttattgc ttatgtttgc
1081 tggttatggt ggtcaactat gtatctgaca caccattatt ttgtagacct tatggcaggt
1141 tctgtgctgt catacgttat tttccagtac acaaagtaca cacatttacc aattgtagat
1201 acatctcttt tttgcagatg gtcatacact tcaattgaga aatacgatat atcaaagagt
1261 gatccattgg ctgcagattc aaacgatatc gaaagtgtcc ctttgtccaa cttggaactt
1321 gactttgatc ttaatatgac tgatgaaccc agtgtaagcc cttcgttatt tgatggatct
1381 acttctgttt ctcgttcgtc cgccacgtct ataacgtcac taggtgtaaa gagggcttaa
1441 ggaaatccat tatgtactat ttaaaaaaca caaacttttg gatgttcggt ttattctttt
1501 tcttttactt ttttatcatg ggagcctact tcccgttttt cccgatttgg ctacatgaca
1561 tcaaccatat cagcaaaagt gatacgggta ttatttttgc cgctatttct ctgttctcgc
1621 tattattcca accgctgttt ggtctgcttt ctgacaaact cggcctcgac tctagcgaat
1681 taattcgtaa tcatgtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca
1741 cacaacatac gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa
1801 ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag
1861 ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc
1921 gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct
1981 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg
2041 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc
2101 cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga
2161 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct
2221 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg
2281 gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag
2341 ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat
2401 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac
2461 aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac
2521 tacggctaca ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc
2581 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt
2641 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc
2701 ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg
2761 agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca
2821 atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca
2881 cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag
2941 ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac
3001 ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc
3061 agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct
3121 agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc
3181 gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg
3241 cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc
3301 gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat
3361 tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag
3421 tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aacacgggat
3481 aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg
3541 cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca
3601 cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga
3661 aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc
3721 ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata
3781 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg
3841 ccacctgggt aataactgat ataattaaat tgaagctcta atttgtgagt ttagtataca
3901 tgcatttact tataatacag ttttttagtt ttgctggccg catcttctca aatatgcttc
3961 ccagcctgct tttctgtaac gttcaccctc taccttagca tcccttccct ttgcaaatag
4021 tcctcttcca acaataataa tgtcagatcc tgtagagacc acatcatcca cggttctata
4081 ctgttgaccc aatgcgtctc ccttgtcatc taaacccaca ccgggtgtca taatcaacca