Cycle Sequence Reactions For Large Insert Plasmid Templates
互联网
The following dye-labeled terminator reaction chemistries have been designed to balance conservation of reagents with the resulting sequence product signal strength. When coupled with BACPAC Resource template preparation, N-free read lengths of >400nts can be expected. More emphasis can be placed on reagent conservation by further volume reduction or dilution; or on sequence product signal strength by increasing the reaction size.
CycleSequenceConditions:
(1) Initial denaturation step: 96 o C 4min.
(2) denaturation: 96 o C 10sec.
(3) annealing: 50 o C 10sec.
(4) extension: 60 o C 4min. run steps 2-4 for 100 cycles.
(5) hold: 4-10 o C.
Primers Useful For BAC and PAC Vectors:
T7.29: 5’ gccgctaatacgactcactatagggagag 29mer
T7: 5’ taatacgactcactataggg 20mer
gSP6: 5’gttttttgcgatctgccgtttc 22mer
3 Stock ABI Ready Reaction mixes are supplemented with 4mM MgCl2
4 Refers to ABI 1x (20ul) reaction
5 Annealing temp can be adjusted, based on Tm of primers used









