Cycle Sequence Reactions For Large Insert Plasmid Templates

 

The following dye-labeled terminator reaction chemistries have been designed to balance conservation of reagents with the resulting sequence product signal strength.  When coupled with BACPAC Resource template preparation, N-free read lengths of >400nts can be expected.  More emphasis can be placed on reagent conservation by further volume reduction or dilution; or on sequence product signal strength by increasing the reaction size.

 

Cycle Sequence Chemistry Conditions:

Chemistry3	Reaction Size4	Final Vol (ul)	Primer Vol (10pmol/ul)	Reaction Mix vol (ul)	Template vol (ul)
ABI dRhod term	1.25x	25	1	10	14
ABI BD term	0.75x	15	1	6	8

 

CycleSequenceConditions:

1) Initial denaturation step: 96^o C 4min. 2)                 denaturation: 96^o C 10sec. 3)                        annealing:  50^o C 10sec. 4)                        extension:  60^o C 4min. run steps 2-4 for 100 cycles. 5)                                hold:  4-10^o C.

Primers Useful For BAC and PAC Vectors:

T7.29:    5’    gccgctaatacgactcactatagggagag    29mer T7:          5’    taatacgactcactataggg     20mer gSP6:       5’    gttttttgcgatctgccgtttc     22mer

---

³ Stock ABI Ready Reaction mixes are supplemented with 4mM MgCl2
⁴ Refers to ABI 1x (20ul) reaction
⁵ Annealing temp can be adjusted, based on Tm of primers used