我要登录|
免费注册
|
我的丁香通
- 企业机构：
- 成为企业机构
- 个人用户：
- 个人中心
移动端

大家都在搜

0 人通过求购买到了急需的产品

免费发布求购

发布求购

Membrane‐Based Yeast Two‐Hybrid System to Detect Protein Interactions

互联网2013-12-31

3038

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

The classical yeast two?hybrid system and its modifications have been successfully used over the past decade to investigate interactions between most classes of proteins expressed in a given cell or tissue. However, some proteins (e.g., integral membrane proteins or nuclear proteins) are relatively difficult to investigate by standard yeast two?hybrid methods either because they are retained at cellular membranes or they activate the system in the absence of a true protein interaction. The membrane?based yeast two?hybrid (MbY2H) system presented in this unit overcomes some of these limitations. It is based on the split?ubiquitin protein complementation assay and detects protein interactions directly at the membrane, thereby allowing the use of full?length integral membrane proteins and membrane?associated proteins as baits to hunt for novel interaction partners. A simple modification also allows the use of proteins that are self?activating in a classical yeast two?hybrid system (e.g., acidic proteins and many transcription factors). Like the yeast two?hybrid system, the MbY2H system can also be used for interaction discovery by screening complex cDNA libraries for novel interaction partners. Curr. Protoc. Protein Sci. 52:19.7.1?19.7.28. © 2008 by John Wiley & Sons, Inc.

Keywords: membrane proteins; membrane?based yeast two?hybrid system; protein interactions

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Strategic Planning
Basic Protocol 1: Bait Construction, Transformation into Yeast Reporter Strain, and Detection by Immunoblotting
Basic Protocol 2: Functional Assay to Determine Bait Suitability for Screening
Basic Protocol 3: Pilot Screen to Optimize the Stringency of Selection
Basic Protocol 4: Screening of a cDNA Library to Identify Novel Interactors
Basic Protocol 5: Plasmid Recovery from Yeast
Basic Protocol 6: Confirmation of Positive Bait‐Prey Interactors
Support Protocol 1: Production of Single‐Stranded Carrier DNA from Salmon Sperm
Support Protocol 2: Preparation of Membrane Extracts from Yeast
Support Protocol 3: Determination of Bait‐Prey Protein Interaction Specificity
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Bait Construction, Transformation into Yeast Reporter Strain, and Detection by Immunoblotting

Materials

cDNA encoding the bait protein
Primers for subcloning bait cDNA into vector:
- Forward primer: 5′‐TACTCTTATggccattacggcc‐NNN NNN NNN NNN NNN NNN NNN‐3′ (where NNN denotes the gene‐specific sequence)
- Reverse primer: 5′‐TACTCTTATggccgaggcggcc‐GC NNN NNN NNN NNN NNN NNN NNN‐3′ (where NNN denotes the gene‐specific sequence)
DNA gel extraction kit (e.g., NucleoSpin Extract II kit, Macherey‐Nagel; Wizard SV Gel and PCR Clean‐up System, Promega)
Appropriate MbY2H bait vector: pBT3‐C, pBT3‐SUC, or pBT3‐STE (Dualsystems Biotech, see and Internet Resources)
Sfi I restriction enzyme
PCR DNA purification kit (e.g. MinElute PCR Purification kit, Qiagen)
Competent E. coli cells (XL1‐Blue, DH10B, TOP10, or similar cloning strains)
LB plates supplemented with kanamycin (see appendix 4A )
Sequencing primers appropriate to the vector:
- pBT3‐C, pBT3‐SUC, and pBT3‐STE
  - Forward primer: 5′‐TGGCATGCATGTGCTCTG‐3′
  - Reverse primer: 5′‐GTAAGGTGGACTCCTTCT‐3′
- pBT3‐N
  - Forward primer: 5′‐CAGAAGGAGTCCACCTTAC‐3′
  - Reverse primer: 5′‐AAGCGTGACATAACTAATTAC‐3′
- pDHB1
  - Forward primer: 5′‐TTTCTGCACAATATTTCAAGC‐3′
  - Reverse primer: 5′‐GTAAGGTGGACTCCTTCT‐3′
1×YPAD liquid medium (see recipe )
NMY51 yeast strain: MATa his3Δ200 trp1‐901 leu2‐3,112 ade2 LYS2::(lexAop)₄ ‐HIS3 ura3::(lexAop)₈ ‐lacZ ade2::(lexAop)₈ ‐ADE2 GAL4 (Dualsystems Biotech, see Internet Resources)
50% (w/v) PEG 4000 (see recipe )
1 M LiOAC (see recipe )
Single‐stranded carrier DNA ( protocol 7 )
Control plasmids: pCCW‐Alg5 (positive control) and pPR3‐N (negative control), Dualsystems Biotech (see Internet Resources)
0.9% (w/v) NaCl
10‐cm plates containing SD solid medium lacking leucine (SD−Leu; see recipe )
10‐cm plates containing SD solid medium lacking tryptophan (SD−Trp; see recipe )
Bait‐specific antibody or mouse monoclonal antibody against LexA (Dualsystems Biotech, see Internet Resources)

Shaking incubator, 30°C
Parafilm

Additional reagents and equipment for performing PCR amplification ( appendix 4J ), restriction enzyme digestion of DNA ( appendix 4I ), agarose gel electrophoresis ( appendix 4F ), and immunoblotting and immunodetection (unit 10.10 ), and for preparing minipreps of plasmid DNA ( appendix 4C )

Basic Protocol 2: Functional Assay to Determine Bait Suitability for Screening

Materials

1×YPAD liquid medium (see recipe )
Yeast strain NMY51 (Dualsystems Biotech, see Internet Resources), growing on plates
50% (w/v) PEG 4000 (see recipe )
1 M lithium acetate (LiOAC; see recipe )
Single‐stranded carrier DNA ( protocol 7 )
Bait construct ( protocol 1 )
Control plasmids: pAI‐Alg5, pDL2‐Alg5, and pPR3‐N (Dualsystems Biotech, see Internet Resources)
10‐cm diameter plates containing SD solid medium lacking tryptophan, leucine, histidine, or adenine (SD−Trp−Leu, SD−Trp−Leu−His, and SD−Trp−Leu−His−Ade; see recipe )
0.9% (w/v) NaCl

Shaking incubator, 30°C
42°C water bath
Parafilm

Basic Protocol 3: Pilot Screen to Optimize the Stringency of Selection

Materials

Bait‐transformed yeast strain NMY51 ( protocol 2 ), growing on plate <2 weeks old
SD liquid medium lacking leucine (SD−Leu; see recipe )
2×YPAD liquid medium (see recipe )
Single‐stranded carrier DNA ( protocol 7 )
1 M lithium acetate (LiOAC; see recipe )
10× TE buffer, pH 7.5: 100 mM Tris·Cl, pH 7.5, 10 mM EDTA (see appendix 2E ); store up to 1 year at room temperature
50% (w/v) PEG 4000 (see recipe )
Library vector pPR3‐N (Dualsystems Biotech, see Internet Resources)
Dimethyl sulfoxide (DMSO)
0.9% (w/v) NaCl
10‐cm plates containing SD medium lacking tryptophan and leucine (SD−Trp−Leu; see recipe )
15‐cm selective plates (six total) containing SD medium lacking tryptophan, leucine and histidine (SD−Trp−Leu−His) and (six total) containing SD−Trp−Leu−His−Ade (adenine; see recipe ), both supplemented with 0, 1, 2.5, 5, 7.5 and 10 mM 3‐amino‐1,2,4‐triazole (3‐AT; see recipe )

Shaking incubator, 30°C
50‐ml conical tube
1‐liter shaker flask
99°C heating block
42°C water bath
Plastic bags with tape or Parafilm

Basic Protocol 4: Screening of a cDNA Library to Identify Novel Interactors

Materials

Bait‐transformed yeast strain NMY51 ( protocol 1 ), growing on plate for no longer than 2 weeks
SD liquid medium lacking leucine (SD−Leu; see recipe )
2× YPAD liquid medium (see recipe )
Single‐stranded carrier DNA ( protocol 7 )
1 M lithium acetate (LiOAc; see recipe )
10× TE buffer: 100 mM Tris·Cl, pH 7.5, 10 mM EDTA (see appendix 2E ); store up to 1 year at room temperature
50% (w/v) PEG 4000 (see recipe )
Appropriate cDNA library (see Internet Resources)
Dimethyl sulfoxide (DMSO)
0.9% (w/v) NaCl
Sixteen 15‐cm diameter selective plates with appropriate selection medium (determined in protocol 3 )
10‐cm plates containing solid SD medium lacking tryptophan and leucine (SD−Trp−Leu; see recipe )

Shaking incubator, 30°C
50‐ml conical tube
1‐liter shaker flask
42°C water bath
Plastic bags with tape or Parafilm

Basic Protocol 5: Plasmid Recovery from Yeast

Materials

Yeast colonies positive for bait/prey interaction ( protocol 4 )
Selection plates (same stringency as protocol 4 )
SD liquid medium lacking tryptophan and leucine (SD−Trp−Leu; see recipe )
Plasmid miniprep kit (e.g., Wizard Plasmid Purification System, Promega), including resuspension buffer, nuclease removal buffer, wash buffer, elution buffer, and spin columns
425 to 600‐µm (30 to 40 U.S. sieve) acid‐washed glass beads (Sigma)
E. coli XL‐1 Blue chemically competent cells (Stratagene)
SOC medium (see appendix 2E ), 37°C
Sfi I restriction enzyme
LB plates supplemented with 100 µg/ml ampicillin (see appendix 2E )

Plastic bags or Parafilm
96‐well deep‐well master block (e.g., Greiner Bio‐One GmbH)
Breathable plate seal (e.g., EasySeal film, Hampton Research)
Shaking incubator, 30°C
Centrifuge with rotor adapted for 96‐well plates
42°C water bath

Additional reagents and equipment for performing restriction enzyme digestion of DNA ( appendix 4I ) and agarose gel electrophoresis ( appendix 4F )

Basic Protocol 6: Confirmation of Positive Bait‐Prey Interactors

Materials

Bait‐transformed yeast strain NMY51 ( protocol 1 ), growing on plate
SD liquid medium lacking leucine (SD−Leu; see recipe )
Prey plasmids derived from the library screen (see protocol 5 )
50% (w/v) PEG 4000 (see recipe )
1 M lithium acetate (LiOAc; see recipe )
Single‐stranded carrier DNA ( protocol 7 )
0.9% (w/v) NaCl
10‐cm plates containing SD solid medium lacking tryptophan and leucine (SD−Trp−Leu plates; see recipe )
10‐cm selective plates of the same stringency as used in the original screen ( protocol 4 )
Appropriate sequencing primers:
- Forward primer for pPR3‐N, pDSL‐Nx, and pNubG‐X library plasmids: 5′‐GTCGAAAATTCAAGACAAGG‐3′
- Reverse primer for pPR3‐N and pDSL‐Nx library plasmids: 5′‐AAGCGTGACATAACTAATTAC‐3′
- Reverse primer for pNubG‐X library plasmids: 5′‐GTTACTCAAGAACAAGAATTTTCG‐3′
- Forward primer for pPR3‐C, pDL2xN, and pX‐NubG library plasmids: 5′‐TTTCTGCACAATATTTCAAGC‐3′
- Reverse primer for pPR3‐C, pDL2xN and pX‐NubG library plasmids: 5′‐CTTGACGAAAATCTGCATGG‐3′

Shaking incubator, 30°C
96‐well master block (e.g., Greiner Bio‐One GmbH) and plate sealers
42°C water bath
Centrifuge with rotor adapted for 96‐well plates
Parafilm

Support Protocol 1: Production of Single‐Stranded Carrier DNA from Salmon Sperm

Materials

Salmon sperm DNA, sodium salt (e.g., deoxyribonucleic acid sodium salt from salmon testes, Sigma)
Sterile H₂ O

250‐ml glass beaker, sterile
Magnetic stirring bar, sterile
Magnetic stirrer
Sterile microcentrifuge tubes
Boiling water bath or 99°C heating block
Ice/water bath

Support Protocol 2: Preparation of Membrane Extracts from Yeast

Materials

Bait or control construct‐bearing NMY51 yeast strain ( protocol 1 )
SD liquid medium lacking leucine (SD−Leu; see recipe ) or SD liquid medium lacking tryptophan (SD−Trp; see recipe )
SDS‐PAGE sample buffer (see unit 10.1 or )
425 to 600‐µm (30 to 40 U.S. sieve) acid‐washed glass beads (Sigma)
Triton X‐100

Shaking incubator, 30°C
50‐ml conical tube
Ultracentrifuge microtubes
Ultracentrifuge
Liquid nitrogen tank, optional

Support Protocol 3: Determination of Bait‐Prey Protein Interaction Specificity

Materials

Bait‐transformed and control yeast strains NMY51 (see protocol 1 )
SD liquid medium lacking leucine (SD−Leu; see recipe )
Prey plasmids derived from library screen (see protocol 5 )
50% (w/v) PEG 4000 (see recipe )
1 M lithium acetate (LiOAc; see recipe )
Single‐stranded carrier DNA ( protocol 7 )
0.9% (w/v) NaCl
10‐cm plates containing SD solid medium lacking tryptophan and leucine (SD−Trp−Leu; see recipe )
10‐cm selective plates of the same stringency as used in the screen (see protocol 4 )

Shaking incubator, 30°C
96‐well deep‐well master block (e.g., Greiner Bio‐One GmbH) and sealer
42°C water bath
Centrifuge with rotor adapted for 96‐well plates
Parafilm

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 19.17.1 Schematic vector maps for MbY2H bait vectors. (A ) pBT3‐SUC vector for type I integral membrane proteins carrying an N‐terminal cleavable signal sequence. (B ) pBT3‐STE vector for type I integral membrane proteins without N‐terminal cleavable signal sequence and for type II integral membrane proteins with a cytosolic C‐terminus. (C ) pBT3‐N bait vector for type II integral membrane proteins with a cytosolic N‐terminus. (D ) pDHB1 membrane anchor bait vector for soluble bait proteins. CYC1p: minimal CYC1 promoter driving expression of the bait fusion proteins. SUC, SUC2 signal sequence derived from the yeast invertase protein; Cub, C‐terminal half of ubiquitin; LexA‐VP16, transcription factor cassette consisting of the E. coli LexA protein and the Herpes simplex VP16 transactivator protein; C/A, CEN/ARS autonomous element for episomal replication in yeast; KanR, kanamycin resistance gene for selection in E. coli ; LEU2, LEU2 auxotrophic marker for selection in yeast; STE, N‐terminal A3 amino acids of S. cerevisiae STE2 protein; Ost4, entire open reading frame of S. cerevisiae Ost4 protein; MCS, multiple cloning site. (E ) Multiple cloning sites for MbY2H vectors.

View Image

Figure 19.17.2 Principle of the MbY2H system. (A ) Using an integral membrane protein as bait. The integral membrane protein is C‐terminally fused to the Cub‐LexA‐VP16 cassette. In the absence of a protein interaction, the LexA‐VP16 transcription factor is immobilized at the membrane and is unable to reach the nucleus of the yeast cell. Consequently, the reporter genes integrated into the yeast genome are silent. (B ) Using a soluble protein as bait. Soluble proteins are anchored to the membrane by an N‐terminal fusion to the small transmembrane protein Ost4p. The Cub‐LexA‐VP16 cassette is fused to the C‐terminus of the soluble protein of interest. (C ) An interacting protein (the prey) is expressed as a fusion to NubG, the mutated N‐terminal half of ubiquitin. NubG may be fused either to the N‐terminus of the prey (NubG‐ x ) or to the C‐terminus ( x ‐NubG). (D ) If bait and prey interact, Cub and NubG are forced into close proximity and reassemble to form split‐ubiquitin, which is recognized by ubiquitin‐specific proteases (UBPs) present in the cytosol of the yeast cell. The UBPs cleave the bait C‐terminal to Cub and release LexA‐VP16, which immediately translocates to the nucleus, where it binds to and activates the reporter genes. The readout for a protein interaction is done by assaying activation of the reporter genes, for example by growth of the yeast on selective minimal medium.

View Image

Videos

Literature Cited

	Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds.) 2008. Current Protocols in Molecular Biology, Chapters 1 and 2. John Wiley & Sons, Hoboken, N.J.
	Fashena, S.J., Serebriiskii, I., and Golemis, E.A. 2000. The continued evolution of two‐hybrid screening approaches in yeast: How to outwit different preys with different baits. Gene 250: 1‐14.
	Fields, S. and Song, O. 1989. A novel genetic system to detect protein‐protein interactions. Nature 340: 245‐246.
	Johnsson, N. and Varshavsky, A. 1994. Split ubiquitin as a sensor of protein interactions in vivo. Proc. Natl. Acad. Sci. U.S.A. 91: 10340‐10344.
	Mockli, N., Deplazes, A., Hassa, P.O., Zhang, Z., Peter, M., Hottiger, M.O., Stagljar, I., and Auerbach, D. 2007. Yeast split‐ubiquitin‐based cytosolic screening system to detect interactions between transcriptionally active proteins. Biotechniques 42: 725‐730.
	Stagljar, I., Korostensky, C., Johnsson, N., and te Heesen, S. 1998. A genetic system based on split‐ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc. Natl. Acad. Sci. U.S.A. 95: 5187‐5192.
	Thaminy, S., Auerbach, D., Arnoldo, A., and Stagljar, I. 2003. Identification of novel ErbB3‐interacting factors using the split‐ubiquitin membrane yeast two‐hybrid system. Genome Res. 13: 1744‐1753.
Internet Resources
	http://psort.ims.u‐tokyo.ac.jp/form2.html
	PSORT, a program used to predict sorting signals in integral membrane proteins.
	http://www.cbs.dtu.dk/services/SignalP
	SignalIP, a program used to predict the N‐terminal cleavable signal sequences found in many type I integral membrane proteins.
	http://www.dualsystems.com
	Additional information on the MbY2H system, including vector maps and sequences, reagents, and available cDNA libraries.