Synthesis and Application of Highly Reactive Amino Linkers for Functional Oligonucleotides

互联网2013-12-31

1933

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

Oligonucleotides are functionalized by conjugation with a variety of molecules, and aliphatic amino linkers have been frequently used as a tether for their modifications. This unit describes the syntheses and applications of novel amino linkers having a carbamate structure. Two major chemical properties of the primary amine are induced by the neighboring effect of the carbamate group, which are found to be optimum in an aminoethyl carbamate structure. First, the hydrophobic monomethoxytrityl group can be rapidly removed from the aminoethyl carbamate under very mild acidic conditions, while the deprotection is not completed in standard aliphatic amines even under high acid concentration. This significant feature enables the convenient purification of amino?modified oligonucleotides by using the hydrophobic interaction of the monomethoxytrityl group with a reverse?phase resin. Second, the introduction of the carbamate linkage reduces the pK _a value of the neighboring primary amine, resulting in an increase in the conjugation yields with various functional molecules, such as those having active esters. The novel amino linkers that have an aminoethyl carbamate linkage indicate potent activity and are applicable for the preparation of various functional oligonucleotides. Curr. Protoc. Nucleic Acid Chem. 48:4.48.1?4.48.23. © 2012 by John Wiley & Sons, Inc.

Keywords: oligonucleotide; amino linker; carbamate; purification; modification; array; conjugation

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: Preparation of ssR Linker Phosphoramidites
Basic Protocol 2: Synthesis and Purification of ssR‐Modified Oligonucleotides
Basic Protocol 3: Incorporation of Reporter Groups to Amino‐Modified Oligonucleotides
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of ssR Linker Phosphoramidites

Materials

(S )‐(+)‐2,2‐Dimethyl‐1,3‐dioxolane‐4‐methanol, 98% ( S.1 ; Aldrich)
1‐(Chloromethyl)naphthalene, 90% ( S.2 ; Aldrich)
Toluene, anhydrous, drying with 4Å molecular sieves
1,4‐Dioxane, anhydrous, drying with 4Å molecular sieve
Potassium hydroxide (KOH)
Argon gas
Ethyl acetate (EtOAc)
Hexane
Brine (saturated aqueous sodium chloride; NaCl)
Sodium sulfate (Na₂ SO₄ ), anhydrous
Acetic acid
Ethanol (EtOH)
Silica gels: Wakogel C‐200 (particle size 75 to 150 µm, Wako Pure Chemical Industries) or Silica Gel 60 (particle size 105 to 210 µm, Nacalai Tasque)
Pyridine, anhydrous, drying with 4Å molecular sieves
p ‐Toluenesulfonyl chloride (p ‐TsCl)
Saturated aqueous sodium hydrogencarbonate (NaHCO₃ )
N ,N ‐Dimethylformamide (DMF), anhydrous, drying with 4 Å molecular sieves
Sodium azide (NaN₃ )
Ammonium chloride (NH₄ Cl)
Palladium‐activated carbon (Pd 10%), (Pd/C)
Hydrogen gas (H₂ )
4‐Methoxytrityl chloride (MMTCl)
Triethylamine (Et₃ N)
(R )‐(–)‐Glycidyl methyl ether ( S.5 ; Wako Pure Chemical Industries)
(S )‐(+)‐1‐Amino‐2‐propanol, 98% ( S.6 c ; Aldrich)
2‐Aminoethanol, 99% ( S.6 d ; Wako Pure Chemical Industries)
1,1′‐Carbonyldiimidazole
4‐Dimethylaminopyridine (DMAP)
6‐Amino‐1‐hexanol
N ,N ‐Diisopropylethylamine (redistilled), 99.5% (Sigma‐Aldrich)
2‐Cyanoethyl N ,N ‐diisopropylchlorophosphoramidite (Wako Pure Chemical Industries)
3‐Amino‐1‐propanol, 98% ( S.10 ; Wako Pure Chemical Industries)
Chloroform (CHCl₃ )
Dimethyl sulfoxide‐d₆ (DMSO‐d₆ ), 99.9% atom% D
Dichloromethane (CH₂ Cl₂ ), anhydrous, drying with 4 Å molecular sieves

50‐, 100‐, 200‐, 300‐, and 500‐mL round‐bottom flasks
Condenser
TLC, Merck silica gel 60F₂₅₄ precoated plates
254‐nm UV lamp (for TLC)
Rotary evaporator equipped with a diaphragm pump
Glass column with a diameter of 2.0 cm, 3.5 cm, 4.0 cm, 4.5 cm, and 5.0 cm
Vacuum oil pump
Celite pad

Additional reagent and equipment for TLC ( appendix 3D ) and column chromatography ( appendix 3E )

Basic Protocol 2: Synthesis and Purification of ssR‐Modified Oligonucleotides

Materials

ssR Linker phosphoramidites ( S.9 a‐d and S.13 ; see protocol 1 )
Acetonitrile (CH₃ CN), anhydrous, drying with 3 Å molecular sieves
Standard 2′‐deoxynucleoside 5′‐O ‐(4,4′‐dimethoxytrityl) phosphoramidites (Glen Research):
- N ‐Benzoyl‐2′‐deoxyadenosine phosphoramidite
- N ‐Benzoyl‐2′‐deoxycytidine phosphoramidite or N ‐Acetyl‐2′‐deoxycytidine phosphoramidite
- N ‐Isobutylyl‐2′‐deoxyguanosine phosphoramidite
- Thymidine phosphoramidite
Argon gas
28% Aq. ammonia
2 M Triethylammonium acetate (TEAA), pH 7.0 (Glen Research)
Sterilized H₂ O
Trifluoroacetic acid
Buffer A: 5% CH₃ CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
Buffer B: 50% CH₃ CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
Buffer C: 20% CH₃ CN in H₂ O (ion‐exchange HPLC)
Buffer D: 20% CH₃ CN in 2 M ammonium formate (ion‐exchange HPLC)

DNA synthesizer
4‐mL screw‐capped glass vial
55°C incubator
Reverse‐phase open column (YMC C18, 500 mg)
Rotary evaporator equipped with a diaphragm pump
0.45 µm disposable filter
1.5‐mL microcentrifuge tubes
HPLC system with:
- Column: 3.9 × 150 mm µ‐Bondasphere (Waters) or 4.6 × 250 mm TSK‐gel DEAE‐2SW (TOSOH)
- Detector: 254 nm

Additional reagents and equipment for automated solid‐phase ONT synthesis ( appendix 3C ) and purification of ONTs (units 10.1 , 10.4 , 10.5 , 10.7 & 3.NaN )

Basic Protocol 3: Incorporation of Reporter Groups to Amino‐Modified Oligonucleotides

Materials

5′‐amino‐modified ONT (X‐25: 5′‐X‐TCTTCCAAGCAATTCCAATGAAAGC, X = ssR, C6, C5; see protocol 2 )
1 M sodium phosphate buffer (pH 8)
Sterilized H₂ O
Fluorescein isothiocyanate (FITC; Dojindo)
N ,N ‐Dimethylformamide (DMF), anhydrous, drying with 4 Å molecular sieves
Biotin succinimidyl ester (Biotin‐NHS) (Dojindo)
2 M Triethylammonium acetate (TEAA), pH 7.0 (Glen Research)
Buffer A, C: 5% CH₃ CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
Buffer B: 50% CH₃ CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
Acetonitrile (CH₃ CN), anhydrous, drying with 3 Å molecular sieves
Argon gas
Cholesteryl chloroformate
4‐Dimethylaminopyridine (DMAP)
N ,N ‐Diisopropylethylamine (DIEA; redistilled), 99.5% (Sigma‐Aldrich)
Dichloromethane (CH₂ Cl₂ ), anhydrous, drying with 4 Å molecular sieves
28% Aq. ammonia
Buffer D: 100% CH₃ CN

NAP10 column (Amersham Pharmacia)
HPLC system with:
- Column: 3.9 × 150 mm µ‐Bondasphere (Waters)
- Detector: 254 nm
0.45‐µm Disposable filter
1.5‐mL microcentrifuge tubes
DNA/RNA synthesizer
4‐mL Screw‐capped glass vial
Rotary evaporator equipped with a diaphragm pump
Sintered glass funnel

Additional reagents and equipment for automated solid‐phase ONT synthesis ( appendix 3C ), and purification of ONTs (units 10.1 , 10.4 , 10.5 , 10.7 & 3.NaN )

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 4.48.1 (A ) Structures of the 5′‐terminal amino linkers. Both C6 and C5 are commercially available linkers. (B ) Schematic drawing for chemical properties of the ssR linker. ONT and MMT indicate the oligonucleotide and monomethoxytrityl group, respectively.

View Image

Figure 4.48.2 Scheme for the synthesis of ssR linker phosphoramidites (see ).

View Image
Figure 4.48.3 Scheme for the synthesis of ssPro linker phosphoramidite (see ).

View Image

Figure 4.48.4 Stability of the MMT group of ssH‐modified ONTs in aqueous buffers. The MMT‐protected ssH‐ONTs were incubated in 250 mM phosphate buffers at pH 6 (solid circles), pH 7 (solid diamonds), and pH 8 (solid triangles), followed by HPLC analyses.

View Image

Figure 4.48.5 HPLC analyses of (A ) The ssH‐modified ONT and (B ) The C6‐modified ONT before and after open column purification. The ONT sequences are 5′‐X‐TCTTCCAAGCAATTCCAATGAAAGC (X‐25, X = ssH and C6).

View Image

Figure 4.48.6 Intramolecular reactions of ssR‐modified ONTs under heated alkaline condition. (A ) Schematic drawing of the reactions. Aminohexyl product (C6 linker, P1) and cyclic carbamate (c‐carbamate) were generated by path 1. The urea form (P2) was generated by path 2. (B ) Percentages of the products (P1 and P2) of each ONTs after ammonia treatment at 60°C for 15 h. White and black bars indicate percentages of P1 and P2 products, respectively.

View Image

Figure 4.48.7 Labeling reactions of X‐25 (X = C6, C5, and ssR) with functional molecules. (A ) Percentages of ONTs labeled with FITC. The reaction was carried out in 250 mM sodium phosphate buffer (pH 8) for 30 min. (B ) C6‐25 (solid diamonds), ssH‐25 (solid circle), and ssN‐25 (solid triangle) were labeled with biotin‐NHS in the presence of various concentrations of the bicarbonate buffer (pH 9 and 8). Percentages of the products are plotted against the buffer concentration.

View Image

Figure 4.48.8 Anti ‐conformation structure of the ssR linker unit.

View Image

Videos

Literature Cited

Literature Cited
	Agrawal, S., Christodoulou, C., and Gait, M.J. 1986. Efficient methods for attaching non‐radioactive labels to the 5′ end of synthetic oligodeoxyribonucleotides. Nucleic Acids Res. 14:6227‐6245.
	Beaucage, S.L. and Iyer, R.P. 1993. The functionalization of oligonucleotides via phosphoramidite derivatives. Tetrahedron 49:1925‐1963.
	Beier, M. and Hoheisel, J.D. 1999. Versatile derivatization of solid support media for covalent bonding on DNA‐microchips. Nucleic Acids Res. 27:1970‐1977.
	Epstein, J.R., Lee, M., and Walt, D.R. 2002. High‐density fiber‐optic genosensor microsphere array capable of zeptomole detection limits. Anal. Chem. 74:1836‐1840.
	Epstein, J.R., Ferguson, J.A., Lee, K.H., and Walt, D.R. 2003. Combinatorial decoding: An approach for universal DNA array fabrication. J. Am. Chem. Soc. 125:13753‐13759.
	Gryaznov, S.M. and Lloyd, D.H. 1993. Modulation of oligonucleotide duplex and triplex stability via hydrophobic interactions. Nucleic Acids Res. 21:5909‐5915.
	Kojima, N., Sugino, M., Mikami, A., Nonaka, K., Fujinawa, Y., Muto, I., Matsubara, K., Ohtsuka, E., and Komatsu, Y. 2006. Enhanced reactivity of amino‐modified oligonucleotides by insertion of aromatic residue. Bioorg. Med. Chem. Lett. 16:5118‐5121.
	Kojima, N., Takebayashi, T., Mikami, A., Ohtsuka, E., and Komatsu, Y. 2009a. Efficient synthesis of oligonucleotide conjugates on solid‐support using an (aminoethoxycarbonyl)aminohexyl group for 5′‐terminal modification. Bioorg. Med. Chem. Lett. 19:2144‐2147.
	Kojima, N., Takebayashi, T., Mikami, A., Ohtsuka, E., and Komatsu, Y. 2009b. Construction of highly reactive probes for abasic site detection by introduction of an aromatic and a guanidine residue into an aminooxy group. J. Am. Chem. Soc. 131:13208‐13209.
	Komatsu, Y., Kojima, N., Sugino, M., Mikami, A., Nonaka, K., Fujinawa, Y., Sugimoto, T., Sato, K., Matsubara, K., and Ohtsuka, E. 2008. Novel amino linkers enabling efficient labeling and convenient purification of amino‐modified oligonucleotides. Bioorg. Med. Chem. 16:941‐949.
	Kumar, R., El‐Sagheer, A., Tumpane, J., Lincoln, P., Wilhelmsson, L.M., and Brown, T. 2007. Template‐directed oligonucleotide strand ligation, covalent intramolecular DNA circularization and catenation using click chemistry. J. Am. Chem. Soc. 129:6859‐6864.
	Lee, L.G., Connell, C.R., and Bloch, W. 1993. Allelic discrimination by nick‐translation PCR with fluorogenic probes. Nucleic Acids Res. 21:3761‐3766.
	Ocampo, S.M., Albericio, F., Fernández, I., Vilaseca, M., and Eritja, R. 2005. A straightforward synthesis of 5′‐peptide oligonucleotide conjugates using N‐Fmoc‐protected amino acids. Org. Lett. 7:4349‐4352.
	Shelbourne, M., Chen, X., Brown, T., and El‐Sagheer, A.H. 2011. Fast copper‐free click DNA ligation by the ring‐strain promoted alkyne‐azide cycloaddition reaction. Chem. Commun. 47:6257‐6259.
	Sinha, N.D. and Cook, R.M. 1988. The preparation and application of functionalized synthetic oligonucleotides: III. Use of H‐phosphonate derivatives of protected amino‐hexanol and mercapto‐propanol or‐hexanol. Nucleic Acids Res. 16:2659‐2669.
	Smith, L.M., Fung, S., Hunkapiller, M.W., Hunkapilerand, T.J., and Hood, L.E. 1985. The synthesis of oligonucleotides containing an aliphatic amino group at the 5′ terminus: Synthesis of fluorescent DNA primers for use in DNA sequence analysis. Nucleic Acids Res. 13:2399‐2412.
	Tetzlaff, C.N., Schwope, I., Bleczinski, C.F., Steinberg, J.A., and Richert, C. 1998. A convenient synthesis of 5′‐amino‐5′‐deoxythymidine and preparation of peptide‐DNA hybrids. Tetrahedron Lett. 39:4215‐4218.
	Venkatesan, N. and Kin, B. H. 2006. Peptide conjugates of oligonucleotides: Synthesis and applications. Chem. Rev. 106:3712‐3761.
	Wachter, L., Jablonski, J.A., and Ramachandran, K.L. 1986. A simple and efficient procedure for the synthesis of 5′‐aminoalkyl oligodeoxynucleotides. Nucleic Acids Res. 14:7985‐7994.
	Weizmann, Y., Chenoweth, D.M., and Swager, T.M. 2011. DNA‐CNT nanowire networks for DNA detection. J. Am. Chem. Soc. 133:3238‐3241.
	Withey, G.D., Kim, J.H., and Xu, J. 2008. DNA‐programmable multiplexing for scalable, renewable redox protein bio‐nanoelectronics. Bioelectrochemistry 74:111‐117.
	Zammatteo, N., Jeanmart, L., Hamels, S., Courtois, S., Louette, P., Hevesi, L., and Remacle, J. 2000. Comparison between different strategies of covalent attachment of DNA to glass surfaces to build DNA microarrays. Anal. Biochem. 280:143‐150.
	Zaramella, S., Yeheskiely, E., and Strömberg, R. 2004. A method for solid‐phase synthesis of oligonucleotide 5′‐peptide‐conjugates using acid‐labile α‐amino protection. J. Am. Chem. Soc. 126:14029‐14035.
	Zatsepin, T.S., Stetsenko, D.A., Gait, M.J., and Oretskaya, T.S. 2005. Use of carbonyl group addition‐elimination reactions for synthesis of nucleic acid conjugates. Bioconjug. Chem. 16:471‐489.