RAMPAGE: Promoter Activity Profiling by Paired‐End Sequencing of 5′‐Complete cDNAs

互联网2013-12-31

3178

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

RNA annotation and mapping of promoters for analysis of gene expression (RAMPAGE) is a method that harnesses highly specific sequencing of 5??complete complementary DNAs to identify transcription start sites (TSSs) genome?wide. Although TSS mapping has historically relied on detection of 5??complete cDNAs, current genome?wide approaches typically have limited specificity and provide only scarce information regarding transcript structure. RAMPAGE allows for highly stringent selection of 5??complete molecules, thus allowing base?resolution TSS identification with a high signal?to?noise ratio. Paired?end sequencing of medium?length cDNAs yields transcript structure information that is essential to interpreting the relationship of TSSs to annotated genes and transcripts. As opposed to standard RNA?seq, RAMPAGE explicitly yields accurate and highly reproducible expression level estimates for individual promoters. Moreover, this approach offers a streamlined 2? to 3?day protocol that is optimized for extensive sample multiplexing, and is therefore adapted for large?scale projects. This method has been applied successfully to human and Drosophila samples, and in principle should be applicable to any eukaryotic system. Curr. Protoc. Mol. Biol . 104:25B.11.1?25B.11.16. © 2013 by John Wiley & Sons, Inc.

Keywords: transcription start site; promoter; RAMPAGE; high?throughput sequencing; expression profiling

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: Preparation of 5′‐Complete cDNAs for Paired‐End Sequencing
Support Protocol 1: Preparation of tRNA Stock Solution
Basic Protocol 2: Analysis of Sequence Data Following Rampage
Reagents and Solutions
Commentary
Literature Cited
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of 5′‐Complete cDNAs for Paired‐End Sequencing

Materials

DNaseI‐treated total RNA
Terminator (TEX) enzyme with buffer A (Epicentre, cat. no. TER51020)
Molecular‐biology grade water (Sigma‐Aldrich, cat. no. 95284‐100ML)
Agencourt RNAClean XP kit (Beckman Coulter, cat. no. A63987)
70% (v/v) ethanol, freshly prepared
Reverse transcription (RT) primer:
- 400 µM rampage_RT:
- 5′‐TAGTCGAACGAAGGTCTCCGAACCGCTCTTCCGATCT(N)₁₅
Template‐switching oligonucleotides (TSOs, Table 25.11.1 ):
- 4 mM rampage_TS_NNNNNN rGrGrG
SuperScript III reverse transcriptase (Invitrogen, 200 U/µl, cat. no. 18080‐085), with first‐strand buffer and 100 mM DTT
10 mM dNTP mix (Invitrogen, cat. no. 18427‐013)
Sorbitol/trehalose solution (see recipe )
5 M betaine (Sigma‐Aldrich, cat. no. B0300‐1VL)
qPCR primers:
- 10 µM CAGEscan‐erF:
- 5′‐AATGATACGGCGACCACCGAGATCTACACTAGTCGAACTGAAGG
- 10 µM CAGEscan‐erR:
- 5′‐CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTG AACCGCTCTTCCGATCT
Power SYBR Green premix (Applied Biosystems, cat. no. 4367659)
Sodium periodate (NaIO₄ , ≥99.8%, Sigma‐Aldrich, cat. no. 311448‐5G)
1 M sodium acetate (NaOAc), pH 4.5: prepare from commercial 3 M NaOAc, pH 5.5 (Ambion, cat. no. AM9740)
40% (v/v) glycerol (Sigma‐Aldrich, cat. no. G5516‐100ML)
1 M Tris‐Cl, pH 7.0 and 8.5: prepare from commercial pH 7.4 stock (Sigma‐Aldrich, cat. no. T2194–100ML) by adjusting pH with HCl or NaOH
Biotin hydrazide, long arm (Vector Laboratories, cat. no. SP‐1100)
1 M sodium citrate, pH 6.0 (Sigma‐Aldrich, cat. no. S1804‐500G)
0.5 M EDTA, pH 8.0 (Ambion, cat. no. AM9260G)
5 to 10 U/µl RNase I (Promega, cat. no. M4261)
10 mg/ml MPG streptavidin beads (PureBiotech, cat. no. MSTR0502)
E. coli tRNA, DNA and protein free (see protocol 2Support Protocol )
Wash buffers 1 to 4 (see reciperecipes )
10 M NaOH (Sigma‐Aldrich, cat. no. 72068‐100ML)
Agencourt AMPure XP kit (Beckman Coulter, cat. no. A63881)
Ex Taq Hot Start (HS) polymerase with buffer and 2.5 mM dNTP mix (Clontech, cat. no. RR006A)
Sequencing primers:
- rampage_r1 (custom primer):
- 5′‐ TAGTCGAACTGAAGGTCTCCAGCA
- SBS8 (standard Illumina primer):
- 5′‐ CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

Support Protocol 1: Preparation of tRNA Stock Solution

Materials

E. coli tRNA (type XX, Sigma‐Aldrich, cat. no. R1753‐500UN)
RQ1 RNase‐free DNase with buffer (Promega, cat. no. M6101)
0.5 M EDTA, pH 8.0 (Ambion, cat. no. AM9260G)
10% SDS (Sigma‐Aldrich, cat. no. G05030‐500ML‐F)
Proteinase K (New England Biolabs, cat. no. P8102S)
Agencourt RNAClean XP kit (Beckman Coulter, cat. no. A63987)
70% (v/v) ethanol
1.5‐ml microcentrifuge tube
Magnet for bead separation

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 25.B1.1 Preparation of RAMPAGE library. Ribosome‐depleted RNA is reverse‐transcribed with random primers bearing an Illumina adaptor sequence overhang. Under the conditions used, the reverse transcriptase will often add a few non‐templated Cs when it reaches the 5′ end of the template, especially if the template is capped. A template‐switching oligo (TSO), which has three riboguanosines at its 3′ end, can hybridize to the terminal Cs, prompting the enzyme to switch templates and add the TSO sequence to the end of the newly synthesized cDNA. Since the TSO bears the other Illumina adaptor sequence, resulting 5′‐complete cDNAs are amplifiable, whereas non‐5′‐complete molecules are not. The next steps implement the cap‐trapping strategy, in which riboses with free 2′‐ and 3′‐hydroxyl groups are oxidized and biotinylated, and single‐stranded portions of RNA are digested by RNase I. This leaves biotin groups at only the 5′ ends of capped transcripts hybridized to 5′‐complete cDNAs, which can then be recovered on streptavidin‐coated beads. After PCR amplification and size selection, the cDNAs selected by these two orthogonal strategies can be directly sequenced on Illumina platforms.

View Image

Videos

Literature Cited

Literature Cited
	Batut, P., Dobin, A., Plessy, C., Carninci, P., and Gingeras, T.R. 2013. High‐fidelity promoter profiling reveals widespread alternative promoter usage and transposon‐driven developmental gene expression. Genome Res. 23:169‐180.
	Benjamini, Y. and Hochberg, Y. 1995. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Series B Stat. Methodol. 57:289‐300.
	Carninci, P., Kvam, C., Kitamura, A., Ohsumi, T., Okazaki, Y., Itoh, M., Kamiya, M., Shibata, K., Sasaki, N., Izawa, M., Muramatsu, M., Hayashizaki, Y., and Schneider, C. 1996. High‐efficiency full‐length cDNA cloning by biotinylated CAP trapper. Genomics 37:327‐ 336.
	Carninci, P., Sandelin, A., Lenhard, B., Katayama, S., Shimokawa, K., Ponjavic, J., Semple, C.A.M., Taylor, M.S., Engstrom, P.G., Frith, M.C., Forrest, A.R.R., Alkema, W.B., Tan, S.L., Plessy, C., Kodzius, R., Ravasi, T., Kasukawa, T., Fukuda, S., Kanamori‐Katayama, M., Kitazume, Y., Kawaji, H., Kai, C., Nakamura, M., Konno, H., Nakano, K., Mottagui‐Tabar, S., Arner, P., Chesi, A., Gustincich, S., Persichetti, F., Suzuki, H., Grimmond, S.M., Wells, C.A., Orlando, V., Wahlestedt, C., Liu, E.T., Harbers, M., Kawai, J., Bajic, V.B., Hume, D.A., and Hayashizaki, Y. 2006. Genome‐wide analysis of mammalian promoter architecture and evolution. Nat. Genet. 38:626‐635.
	Djebali, S., Davis, C.A., Merkel, A., Dobin, A., Lassmann, T., Mortazavi, A., Tanzer, A., Lagarde, J., Lin, W., Schlesinger, F., Xue, C., Marinov, G.K., Khatun, J., Williams, B.A., Zaleski, C., Rozowsky, J., Roder, M., Kokocinski, F., Abdelhamid, R.F., Alioto, T., Antoshechkin, I., Baer, M.T., Bar, N.S., Batut, P., Bell, K., Bell, I., Chakrabortty, S., Chen, X., Chrast, J., Curado, J., Derrien, T., Drenkow, J., Dumais, E., Dumais, J., Duttagupta, R., Falconnet, E., Fastuca, M., Fejes‐Toth, K., Ferreira, P., Foissac, S., Fullwood, M.J., Gao, H., Gonzalez, D., Gordon, A., Gunawardena, H., Howald, C., Jha, S., Johnson, R., Kapranov, P., King, B., Kingswood, C., Luo, O.J., Park, E., Persaud, K., Preall, J.B., Ribeca, P., Risk, B., Robyr, D., Sammeth, M., Schaffer, L., See, L.H., Shahab, A., Skancke, J., Suzuki, A.M., Takahashi, H., Tilgner, H., Trout, D., Walters, N., Wang, H., Wrobel, J., Yu, Y., Ruan, X., Hayashizaki, Y., Harrow, J., Gerstein, M., Hubbard, T., Reymond, A., Antonarakis, S.E., Hannon, G., Giddings, M.C., Ruan, Y., Wold, B., Carninci, P., Guigo, R., and Gingeras, T.R. 2012. Landscape of transcription in human cells. Nature 489:101‐108.
	Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. 2012. STAR: Ultrafast universal RNA‐seq aligner. Bioinformatics 29:15‐21.
	Hirzmann, J., Luo, D., Hahnen, J., and Hobom, G. 1993. Determination of messenger‐RNA 5′‐ends by reverse transcription of the cap structure. Nucleic Acids Res. 21:3597‐3598.
	Kapranov, P., Willingham, A.T., and Gingeras, T.R. 2007. Genome‐wide transcription and the implications for genomic organization. Nat. Rev. Genet. 8:413‐423.
	Ni, T., Corcoran, D.L., Rach, E.A., Song, S., Spana, E.P., Gao, Y., Ohler, U., and Zhu, J. 2010. A paired‐end sequencing strategy to map the complex landscape of transcription initiation. Nat. Methods. 7:521‐527.
	Plessy, C., Bertin, N., Takahashi, H., Simone, R., Salimullah, M., Lassmann, T., Vitezic, M., Severin, J., Olivarius, S., Lazarevic, D., Hornig, N., Orlando, V., Bell, I., Gao, H., Dumais, J., Kapranov, P., Wang, H., Davis, C.A., Gingeras, T.R., Kawai, J., Daub, C.O., Hayashizaki, Y., Gustincich, S., and Carninci, P. 2010. Linking promoters to functional transcripts in small samples with nanoCAGE and CAGEscan. Nat. Methods. 7:528‐534.
	Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. 2010. Transcript assembly and quantification by RNA‐Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28:511‐515.
	Valen, E., Pascarella, G., Chalk, A., Maeda, N., Kojima, M., Kawazu, C., Murata, M., Nishiyori, H., Lazarevic, D., Motti, D., Marstrand, T.T., Tang, M.H.E., Zhao, X., Krogh, A., Winther, O., Arakawa, T., Kawai, J., Wells, C., Daub, C., Harbers, M., Hayashizaki, Y., Gustincich, S., Sandelin, A., and Carninci, P. 2009. Genome‐wide detection and analysis of hippocampus core promoters using DeepCAGE. Genome Res. 19:255‐265.
	Wang, Z., Gerstein, M., and Snyder, M. 2009. RNA‐Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 10:57‐63.
	Zhu, Y.Y., Machleder, E.M., Chenchik, A., Li, R. and Siebert, P.D. 2001. Reverse transcriptase template switching: A SMART approach for full‐length cDNA library construction. Biotechniques 30:892‐897.