Inducing and Characterizing Liver Regeneration in Mice: Reliable Models, Essential “Readouts” and Critical Perspectives

互联网2013-12-31

2777

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

Elucidating the molecular circuitry that regulates regenerative responses in mammals has recently attracted considerable attention because of its emerging impact on modern bioengineering, tissue replacement technologies, and organ transplantation. The liver is one of the few organs of the adult body that exhibits a prominent regenerative capacity in response to toxic injury, viral infection, or surgical resection. Over the years, mechanistic insights into the liver's regenerative potential have been provided by rodent models of chemical liver injury or surgical resection that faithfully recapitulate hallmarks of human pathophysiology and trigger robust hepatocyte proliferation leading to organ restoration. The advent of mouse transgenics has undeniably catalyzed the wider application of such models for researching liver pathobiology. This article provides a comprehensive overview of the most reliable and widely applied murine models of liver regeneration and also discusses helpful hints, considerations, and limitations related to the use of these models in liver regeneration studies. Curr. Protoc. Mouse Biol . 3:141?170 © 2013 by John Wiley & Sons, Inc.

Keywords: liver; partial hepatectomy; hepatotoxicity; carbon tetrachloride; hepatocytes; proliferation; regeneration

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Liver Regeneration: Overview
Basic Protocol 1: Inducing Liver Regeneration in Mice: The 2/3 Partial Hepatectomy Model (Suture Ligation Technique)
Basic Protocol 2: The CCl4‐Induced Acute Liver Injury and Regeneration Model
Support Protocol 1: Harvesting Mouse Organs and Blood
Support Protocol 2: Quantifying Hepatocyte Cell Cycle Re‐Entry by Means of BrdU Immunohistochemistry
Support Protocol 3: Preparation of Nuclear Protein Extracts from Mouse Liver
Support Protocol 4: Probing the Activation of Transcriptional Networks that Promote Liver Regeneration (Electrophoretic Mobility Shift Assay)
Reagents and Solutions
Commentary
Figures
Tables

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Inducing Liver Regeneration in Mice: The 2/3 Partial Hepatectomy Model (Suture Ligation Technique)

Materials

8‐ to 14‐week old mice
70% and 95% (v/v) ethanol
Isoflurane for anesthesia
Iodine/betadine (Ricca Chemical, cat. no. 3955‐16, or equivalent; http://riccachemical.com)
0.9% (w/v) NaCl solution (normal saline) or phosphate‐buffered saline (PBS), sterile
Ophthalmic ointment (Valleyvet, cat. no. 37327; http://www.valleyvet.com/)
10% formalin and/or liquid N₂ (if processing resected tissues)
Surgical instrument cleaner (Integra Miltex, cat. no. 3‐720; http://www.integralife.com/)

5‐0 silk suture (Roboz, cat. no. SUT‐15‐1) for occluding blood flow to liver lobes (supplied as a spool)
1 Petri dish
1 Autoclavable case or tray for sterilizing surgical instruments (Roboz, cat. no. RS‐9910)
2 Curved microdissecting forceps (Roboz, cat. no. RS‐5135)
1 Operating scissors (Roboz, cat. no. RS‐6702)
3 Hemostatic forceps (Roboz, cat. no. RS‐7291)
1 Microdissecting scissors (preferably with curved blades; Roboz, cat. no. RS‐5913)
1 Small tube or thin gauze roll (∼12 × 75 mm)
Gaymar TP500 water pump for heated bed (Molecular Imaging, cat. no. PM‐04‐0009‐NP): the use of a water pump with circulating heated water minimizes the rodents' heat loss during surgery and aids post‐surgical recovery.
Germinator dry bead sterilizer (Roboz, cat. no. DS‐401) for instrument sterilization (between surgeries)
6‐in. w. × 8‐in. d. heated hard pad for surgical bed (Molecular Imaging, cat. no. AV‐03‐0053)
2 Paper towels per surgery
Transparent tape
1 Plastic or styrofoam pad for prep area bed
Isoflurane vaporizer (for mouse anesthesia; SurgiVet)
2 Small beakers (∼50 ml)
1 15‐ or 50‐ml conical tube (e.g., BD Falcon) for normal saline or PBS
1 15‐ or 50‐ml conical tube for 10% formalin (if fixing resected liver tissue)
1 1.5‐ml screw‐cap cryotube (if freezing resected liver tissue)
2‐ to 3‐ml syringes
1 Sub‐Q or 27‐ to 30‐G 1/2‐in. needle (Becton Dickinson)
1 Small chamber (e.g., a desiccator vessel) for initial rodent anesthetization
Animal balance
Nose cones (Molecular Imaging, cat. no. AS‐01‐0305)
2 Mapelson‐D rebreathers (Molecular Imaging, cat. no. AS‐01‐0500‐07)
2 Mask stabilizers (Molecular Imaging, cat. no. AA‐00‐0322)
Electric razor for shaving mouse fur
4 6‐in. cotton swabs per surgery
1 Sterile cotton swab per surgery (Fisher, cat. no. 14‐959‐90)
1 Sterile surgical drape per surgery (8‐in. × 8‐in.; GEPCO, cat. no. 88VCSTF)
2 Pads or rolled‐up aluminum foil (∼2 × 2 × 10 cm) to prop up hemostatic forceps
1 Sterile gauze pad per surgery (Fisher, cat. no. 19808936)
1 Needle holder (Roboz, cat. no. RS‐7832)
1 5‐0 silk suture (Roboz, cat. no. SUT‐1073‐21) with attached 12‐mm cutting needle for muscle and skin closure (one suture can usually be used for two to three surgeries)
2 Trays for washing instruments

Basic Protocol 2: The CCl4‐Induced Acute Liver Injury and Regeneration Model

Materials

Mice, 14‐16 weeks old, (preferable strain: C57BL/6, gender: female)
Carbon tetrachloride (CCl₄ ; Sigma‐Aldrich, cat. no. 289116; avoid breathing vapors)
Mineral oil (light oil; Sigma, cat. no. M5904)
70% and 100% ethanol
Surgical instrument cleaner (Integra Miltex, cat. no. 3‐720) or laboratory detergent

Animal balance
1 15‐ or 50‐ml conical tube for mixing CCl₄ and mineral oil
1 Hamilton microliter syringe with a 0.25 to 0.5 ml calibrated barrel and 22S/2"/2 needle
1 Gauze pad
3 50‐ml conical tubes (e.g., BD Falcon) for holding solutions to wash the syringe

Support Protocol 1: Harvesting Mouse Organs and Blood

Materials

Mouse subjected to partial hepatectomy ( protocol 1 ) or CCl₄ acute liver injury ( protocol 2 )
70% ethanol
10% formalin or 0.9% NaCl (for liver perfusion)
0.5 M EDTA (if plasma is desired and no coated tubes are available)
Liquid N₂ (if frozen tissue is desired)

1 1‐ml syringe with 25‐G, 5/8‐in. needle
1 Operating scissors
1 Microdissecting forceps
2 Hemostatic forceps
1 Microdissecting scissors
1 Microtainer tube for blood collection per mouse (with or without a serum separator or EDTA coating, depending on whether plasma or serum is desired; a microcentrifuge tube can be used as an alternative)
1 10‐ml syringe with 25‐G, 5/8 needle
1.5‐ml screw‐cap cryotubes (if frozen tissue is desired)
15‐ or 50‐ml conical tubes (e.g., BD Falcon) for 10% formalin (if tissue fixation is desired)

Additional reagents and equipment for isoflurane anesthesia of mice (see relevant steps of protocol 1 )

Support Protocol 2: Quantifying Hepatocyte Cell Cycle Re‐Entry by Means of BrdU Immunohistochemistry

Materials

Slides of liver and intestinal tissue previously fixed with 10% formalin ( protocol 3 ) and paraffin‐embedded
BrdU (Sigma)
Sterile PBS or 0.9% NaCl (normal saline) for injections
PBS, pH 7.4 (500 ml to 1 liter) for immunohistochemistry
Horse serum
Xylene
95%, 80%, and 70% ethanol
Citric acid buffer (see recipe )
Methanol
30% Hydrogen peroxide (H₂ O₂ )
Avidin/Biotin Blocking Kit (Vector, cat. no. SP‐2001)
Anti‐BrdU antibody (Millipore, clone AH4H7‐1/131‐14871, cat. no. MAB3424)
PBT (see recipe )
Horse anti‐mouse antibody (Vector, cat. no. BA‐2000, rat‐adsorbed)
Vectastain Kit (Vector, cat. no. PK‐4000)
DAB Substrate Kit (Vector, cat. No. SK‐4100)
Hematoxylin stain, Gill's Formulation #2 (optional for DNA counterstaining)
Permount (Fisher, cat. no. SP‐15)

Animal balance
1 1‐ml syringe with 25‐ to 27‐G, 3/8‐in. needle
Staining jars (50‐ml volume for 1 to 5 slides; 100‐ml volume for 6 to 10 slides)
Large tray or Petri dish for humidified chamber (preferably one commercially available; e.g., Scientific Device Laboratory, cat. no. 197‐CR; http://www.scientificdevice.com/)
Whatman 3MM paper
Serological pipets (if commercially available humidified chamber is not used)
1 Plastic slide rack
1 1‐liter plastic beaker
1 Vacuum trap flask with attached Pasteur pipet
1 Calbiochem Hydrophobic ImmunoPen (EMD Millipore, cat. no. 402176)
Parafilm (if blocking slides overnight)
2 15‐ml conical tubes
Glass coverslips

Additional reagents and equipment for harvesting blood and/or organs ( protocol 3 ) and intraperitoneal injection (as for CCl₄ injection; see protocol 2 , step 6)

Support Protocol 3: Preparation of Nuclear Protein Extracts from Mouse Liver

Materials

Homogenization buffer (see recipe )
Buffer C (see recipe )
Buffer D (see recipe )
Mouse liver tissue portion (best if fresh, but snap‐frozen tissue can be used)
PBS, ice cold
Laboratory detergent
95% ethanol

1 Large glass Dounce homogenizer tube and pestle per liver (or reuse after cleaning)
1 Glass petri dish per liver
1 Razor blade per liver
1 50‐ml conical tube (e.g., BD Falcon)
Beckman ultracentrifuge with SW41 rotor
Swinging buckets for SW41 rotor
Beckman TL‐100 tabletop ultracentrifuge with TLA‐45 rotor and tubes (if this is not available, a Beckman J2‐21 centrifuge with JA‐20 rotor or similar, with 15‐ml Corex tubes and screw‐top microcentrifuge tubes can be used)
1 Plastic SW41 ultracentrifuge tube (14 × 89 Ultra Clear) per liver (if an odd number of livers are processed, one extra tube will be required as a balance)
Balance (optional; Mettler)
1 Glass petri dish per liver
1 Razor blade per liver
1 Large glass Dounce homogenizer tube and pestle per liver (or reuse after cleaning)
Overhead stirrer
1 Spatula per liver
1 Small plastic homogenizer tube and pestle (Kontes) per liver
Dialysis tubing membrane (MWCO 20,000 or smaller)
Microdialyzer (Spectrum)
Magnetic stirrer and stir bar

Additional reagents and equipment for protein assay (Simonian and Smith, )

Support Protocol 4: Probing the Activation of Transcriptional Networks that Promote Liver Regeneration (Electrophoretic Mobility Shift Assay)

Materials

Double‐stranded, desalted, HPLC‐purified oligonucleotide probe (175 pmol to 50 nmol, purchased commercially or synthesized at a core facility)—the following sequences can be used:
NF‐κB = 5′‐AGTTGAGGGGACTTTCCCAGGC‐3′; consensus sequence (Promega Corp., cat. no. E3291)
STAT3 = 5′‐GATCCTCCAGCATTTCCCGTAAATCCTCCAG‐3′; cis‐inducible factor (SIF) binding element in the c‐fos promoter
E2 = 5′‐GGTTCCAGACCGCGATTGGTGGCTGGA‐3′; used as a loading control
DNA 5′‐end labeling kit (Promega)
10,000 µCi/ml [γ ‐³² P]ATP (sp. act., 3000 Ci/mmol; GE Life Sciences, cat. no. AA0068)
Appropriate 2× gel shift reaction buffer (see recipe )
30% (w/v) acrylamide
0.5× and 10× TBE buffer (see recipe )
80% (v/v) glycerol
10% (w/v) ammonium persulfate (APS)
TEMED
Liver nuclear extract ( protocol 5 )
Poly(deoxyinosinic‐deoxycytidylic) acid sodium salt (Poly dI:dC; Sigma, cat. no. P4929, or equivalent)
Appropriate antibody for “super‐shift”

G‐25 Sephadex spin column (GE Life Sciences, cat. no. 27‐5325‐01)
Scintillation counter
Electrophoresis equipment (gel box and power supply)
Gel dryer
Whatman 3MM filter paper
Autoradiography film
Automatic X‐ray film developer (for autoradiography) or developer/fixer solutions for manual processing of the film in a darkroom

Additional reagents and equipment for gel electrophoresis (Gallagher, )

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 1. Schematic diagram of the anatomy of the mouse liver. This diagram illustrates the basic anatomical features of the mouse liver, including its distinct lobular architecture and intrahepatic circulation, and the positioning of the ligatures (brown dashed lines) used in the partial hepatectomy technique. TF, transcription factor.

View Image

Figure 2. Stages of the partial hepatectomy procedure. (A ) Iodine treatment and the dashed line delineate the area shaved in preparation for the surgery. (B ) Forceps are used to pull up on the muscle layer, clearly showing the linea alba (yellow arrow) for the incision. (C ) The left lateral lobe (LLL) and two segments of the median lobe [right (RML) and left (LML)] to be resected are outlined. The gallbladder, which is also removed, is indicated by the yellow arrow. (D , E ) A distant (D) and close‐up (E) view of the top membrane (yellow arrow) to be cut. The gallbladder is also clearly visible. (F , G ). A distant (F) and close‐up (G) view of the second membrane (yellow arrows indicate the approximate start and end) to be cut is shown. Also delineated are the right lateral (RLL) and caudate (CL) lobes (each of which consists of two or three segments, not delineated) that will be left intact after the surgery, and which are visible when the median lobe (ML) and LLL are lifted. (H ) Posterior view showing placement of the first suture at the base of the LLL. (I ) Anterior view of the suture wrapped around the stem of the LLL. (J ) View of the LLL after tightening the knot of the suture in (I). Note the darker color of the now ischemic LLL (yellow asterisk) after blood flow has been restricted. (K ) Posterior view showing placement of the second suture at the base of the ML. (L ) Anterior view of the suture wrapped around the stem of the ML. Note that in this case the suture is not placed at the very base of the stem, but tied somewhat forward of it, pinching in some of the surrounding tissue. (M ) View of the ischemic ML after tightening the knot of the suture in (L). (N ) A small remnant piece of tissue remains after resecting the ML. (O ) View of the remnant tissue after resecting both the ML and LLL, with the remaining RLL and CL clearly visible. Note that the source of the pooled blood in (N) and (O) is the resected lobes, and not bleeding from the remnant tissue. This blood should be cleaned out by the saline/PBS wash in step 25 of the protocol. (P ) Close‐up view of the initial sutures for the muscle layer, showing the beginning knot and first continuous suture. Note the lack of blood around the incision due to a proper cut along the linea alba. (Q ) Distant view of the muscle layer after it has been closed by continuous sutures. (R ) Distant view of the skin after it has been closed by continuous sutures.

View Image

Videos

Literature Cited

Literature Cited
	Bhathal, P.S., Rose, N.R., Mackay, I.R., and Whittingham, S. 1983. Strain differences in mice in carbon tetrachloride‐induced liver injury. Br. J. Exp. Pathol.64:524‐533.
	Bucher, N.L. 1963. Regeneration of mammalian liver. Int. Rev. Cytol.15:245‐300.
	Cook, M.J. 1965. The Anatomy of the Laboratory Mouse. pp. 87‐95. Academic Press, London & New York.
	Cressman, D.E., Greenbaum, L.E., DeAngelis, R.A., Ciliberto, G., Furth, E.E., Poli, V., and Taub, R. 1996. Liver failure and defective hepatocyte regeneration in interleukin‐6‐deficient mice. Science274:1379‐1383.
	DeAngelis, R.A., Markiewski, M.M., Taub, R., and Lambris, J.D. 2005. A high‐fat diet impairs liver regeneration in C57BL/6 mice through overexpression of the NF‐kappaB inhibitor, IkappaBalpha. Hepatology42:1148‐1157.
	Desbois‐Mouthon, C., Wendum, D., Cadoret, A., Rey, C., Leneuve, P., Blaise, A., Housset, C., Tronche, F., Le, B.Y., and Holzenberger, M. 2006. Hepatocyte proliferation during liver regeneration is impaired in mice with liver‐specific IGF‐1R knockout. FASEB J.20:773‐775.
	Doolittle, D.J., Muller, G., and Scribner, H.E. 1987. Relationship between hepatotoxicity and induction of replicative DNA synthesis following single or multiple doses of carbon tetrachloride. J. Toxicol. Environ. Health22:63‐78.
	Fausto, N. 2000. Liver regeneration. J. Hepatol.32:19‐31.
	Fausto, N., Campbell, J.S., and Riehle, K.J. 2012. Liver regeneration. J. Hepatol.57:692‐694.
	Gallagher, S.R. 2012. SDS‐polyacrylamide gel electrophoresis (SDS‐PAGE). Curr. Protoc. Essential Lab. Tech.6:7.3.1‐7.3.28.
	Heijboer, A.C., Donga, E., Voshol, P.J., Dang, Z.C., Havekes, L.M., Romijn, J.A., and Corssmit, E.P. 2005. Sixteen hours of fasting differentially affects hepatic and muscle insulin sensitivity in mice. J. Lipid Res.46:582‐588.
	Higgins, G.M. and Anderson, R.M. 1931. Experimental pathology of the liver I. Restoration of the liver of the white rat following partial surgical removal. Arch. Pathol.12:186‐202.
	Honkakoski, P., Kojo, A., and Lang, M.A. 1992. Regulation of the mouse liver cytochrome P450 2B subfamily by sex hormones and phenobarbital. Biochem. J.285:979‐983.
	Jaeschke, H., McGill, M.R., Williams, C.D., and Ramachandran, A. 2011. Current issues with acetaminophen hepatotoxicity: A clinically relevant model to test the efficacy of natural products. Life Sci.88:737‐745.
	Johnston, D.E. and Kroening, C. 1998. Mechanism of early carbon tetrachloride toxicity in cultured rat hepatocytes. Pharmacol. Toxicol.83:231‐239.
	Kim, Y.C., Yim, H.K., Jung, Y.S., Park, J.H., and Kim, S.Y. 2007. Hepatic injury induces contrasting response in liver and kidney to chemicals that are metabolically activated: Role of male sex hormone. Toxicol. Appl. Pharmacol.223:56‐65.
	Kovalovich, K., DeAngelis, R.A., Li, W., Furth, E.E., Ciliberto, G., and Taub, R. 2000. Increased toxin‐induced liver injury and fibrosis in interleukin‐6‐deficient mice. Hepatology31:149‐159.
	Martins, P.N., Theruvath, T.P., and Neuhaus, P. 2008. Rodent models of partial hepatectomies. Liver Int.28:3‐11.
	Michalopoulos, G.K. 2007. Liver regeneration. J. Cell. Physiol.213:286‐300.
	Michalopoulos, G.K. 2010. Liver regeneration after partial hepatectomy: Critical analysis of mechanistic dilemmas. Am. J. Pathol.176:2‐13.
	Mitchell, C. and Willenbring, H. 2008. A reproducible and well‐tolerated method for 2/3 partial hepatectomy in mice. Nat. Protoc.3:1167‐1170.
	Olle, E.W., Ren, X., McClintock, S.D., Warner, R.L., Deogracias, M.P., Johnson, K.J., and Colletti, L.M. 2006. Matrix metalloproteinase‐9 is an important factor in hepatic regeneration after partial hepatectomy in mice. Hepatology44:540‐549.
	Orlando, G., Baptista, P., Birchall, M., De, C.P., Farney, A., Guimaraes‐Souza, N.K., Opara, E., Rogers, J., Seliktar, D., Shapira‐Schweitzer, K., Stratta, R.J., Atala, A., Wood, K.J., and Soker, S. 2011. Regenerative medicine as applied to solid organ transplantation: Current status and future challenges. Transpl. Int.24:223‐232.
	Simonian, M.H. and Smith, J.A. 2006. Spectrophotometric and colorimetric determination of protein concentration. Curr. Protoc. Mol. Biol.76:10.1A.1‐10.1A.9.
	Strey, C.W., Markiewski, M., Mastellos, D., Tudoran, R., Spruce, L.A., Greenbaum, L.E., and Lambris, J.D. 2003. The proinflammatory mediators C3a and C5a are essential for liver regeneration. J. Exp. Med.198:913‐923.
	Taub, R. 2004. Liver regeneration: From myth to mechanism. Nat. Rev. Mol. Cell Biol.5:836‐847.
	Tunon, M.J., Alvarez, M., Culebras, J.M., and Gonzalez‐Gallego, J. 2009. An overview of animal models for investigating the pathogenesis and therapeutic strategies in acute hepatic failure. World J. Gastroenterol.15:3086‐3098.
	Wustefeld, T., Rakemann, T., Kubicka, S., Manns, M.P., and Trautwein, C. 2000. Hyperstimulation with interleukin 6 inhibits cell cycle progression after hepatectomy in mice. Hepatology32:514‐522.
	Yager, J.D., Zurlo, J., Sewall, C.H., Lucier, G.W., and He, H. 1994. Growth stimulation followed by growth inhibition in livers of female rats treated with ethinyl estradiol. Carcinogenesis15:2117‐2123.
	Yokoyama, H.O., Wilson, M.E., Tsuboi, K.K., and Stowell, R.E. 1953. Regeneration of mouse liver after partial hepatectomy. Cancer Res.13:80‐85.
Key Reference
	Mitchell and Willenbring, 2008. See above.
	This article provides an authoritative overview of the 2/3 partial hepatectomy technique and a comprehensive outline of the surgical procedure for inducing liver regeneration in mice. It also discusses critical parameters affecting experimental design, including limitations and potential caveats that should be taken into consideration when designing similar studies.