Genome‐Wide Annotation and Quantitation of Translation by Ribosome Profiling

互联网2013-12-31

3026

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

Recent studies highlight the importance of translational control in determining protein abundance, underscoring the value of measuring gene expression at the level of translation. A protocol for genome?wide, quantitative analysis of in vivo translation by deep sequencing is presented here. This ribosome?profiling approach maps the exact positions of ribosomes on transcripts by nuclease footprinting. The nuclease?protected mRNA fragments are converted into a DNA library suitable for deep sequencing using a strategy that minimizes bias. The abundance of different footprint fragments in deep sequencing data reports on the amount of translation of a gene. Additionally, footprints reveal the exact regions of the transcriptome that are translated. To better define translated reading frames, an adaptation that reveals the sites of translation initiation by pre?treating cells with harringtonine to immobilize initiating ribosomes is described. The protocol described requires 5 to 7 days to generate a completed ribosome profiling sequencing library. Sequencing and data analysis requires an additional 4 to 5 days. Curr. Protoc. Mol. Biol. 103:4.18.1?4.18.19. © 2013 by John Wiley & Sons, Inc.

Keywords: genomics; translation; next?generation; sequencing

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: Ribosome Profiling in Cultured Mammalian Cells
Alternate Protocol 1: Pre‐Treatment of Cultured Cells with Elongation Inhibitors
Alternate Protocol 2: Pre‐Treatment of Cultured Cells with Initiation Inhibitors
Support Protocol 1: Primary Analysis of Ribosome Profiling Data
Reagents and Solutions
Commentary
Literature Cited
Figures

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Ribosome Profiling in Cultured Mammalian Cells

Materials

Cultures of adherent mammalian cells, e.g., mouse embryonic stem cells (mESCs), HEK293 cells (Ingolia et al., ), HeLa cells, mouse neutrophils (Guo, ), or PC3 cells (Hsieh, ), grown in 10‐cm dishes
Phosphate‐buffered saline, pH 7.2 (PBS, appendix 22 ), ice cold
Lysis buffer (see recipe ), ice cold
100 U/µl RNase I
20 U/µl SUPERase‐In (Life Technologies)
1 M sucrose cushion (see recipe ), ice cold
miRNeasy RNA isolation kit (Qiagen)
15 mg/ml GlycoBlue
10 mM Tris⋅Cl, pH 8 ( appendix 22 )
10 µM upper‐ and lower‐size marker oligoribonucleotides (Phos indicates 3′ phosphorylation):
- 5′‐AUGUACACGGAGUCGAGCUCAACCCGCAACGCGA‐(Phos)
- 5′‐AUGUACACGGAGUCGACCCAACGCGA‐(Phos)
10,000× SYBR Gold (Life Technologies)
1× TBE ( appendix 22 )
10× T4 polynucleotide kinase buffer
10 U/µl T4 polynucleotide kinase
0.5 µg/µl preadenylylated 3′ linker (rApp indicates 5′ adenylylation and X indicates a blocked 3′ terminus):
- 5′‐rAppCTGTAGGCACCATCAAT‐(X)
10× T4 RNA ligase 2 buffer
50% (w/v) PEG 8000
200 U/µl T4 RNA ligase 2, truncated
1.25 µM reverse transcription primer (Phos indicates 5′‐phosphorylation and ‐(SpC18)‐ indicates a hexa‐ethyleneglycol spacer):
- 5′‐(Phos)‐AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC‐(SpC18)‐CACTCA‐(SpC18)‐TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG.
5× first‐strand buffer
10 mM each dNTP mix ( appendix 22 )
0.1 M dithiothreitol ( appendix 22 )
200 U/µl M‐MuLV reverse transcriptase, RNase H^–
1 N NaOH ( appendix 22 )
10× CircLigase buffer
1 mM ATP ( appendix 22 )
50 mM MnCl₂ ( appendix 22 )
100 U/µl CircLigase I (Epicentre)
Subtraction oligo mix (see recipe )
20× SSC ( appendix 22 )
MyOne C1 Streptavidin DynaBeads (Life Technologies)
1× and 2× bind/wash buffer (see recipe )
5× Phusion HF buffer
100 µM forward library PCR primer:
- 5′‐ AATGATACGGCGACCACCGAGATCTACAC
100 µM indexed reverse library PCR primers (NNNNNN indicates the reverse complement of the index sequence captured during Illumina sequencing):
- 5′‐CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCG.
2 U/µl Phusion polymerase
QuantiFluor dsDNA System (Promega)
BioAnalyzer high‐sensitivity DNA kit (Agilent)
TruSeq SBS v3 kit, 50 cycles (Illumina)
TruSeq SR Cluster kit v3, cBot, HiSeq (Illumina)

Aspirator
Cell lifter
1.5‐ml non‐stick, RNase‐free microcentrifuge tubes
26‐G needle
1‐ml syringe
13 × 51–mm polycarbonate ultracentrifuge tube
Optima TLX ultracentrifuge (Beckman Coulter)
TLA 100.3 rotor (Beckman Coulter)
Blue‐light transilluminator
37°C, 70°C, and 80°C heating blocks
0.2‐ml PCR tubes
Thermal cycler
DynaMag‐2 magnetic separation rack (Life Technologies)
PCR tube strips
Fluorimeter
2100 BioAnalyzer (Agilent)
GAII or HiSeq deep sequencer (Illumina)

Additional reagents and equipment for purification and concentration of DNA and RNA (unit 2.1 ), non‐denaturing polyacrylamide gel electrophoresis and subsequent recovery of DNA (unit 2.7 ), and denaturing polyacrylamide gel electrophoresis and subsequent recovery of DNA and RNA (unit 2.12 )

Alternate Protocol 1: Pre‐Treatment of Cultured Cells with Elongation Inhibitors

Materials

Adherent cultured cells (see protocol 1 , Materials)
100 mg/ml cycloheximide in DMSO or 100 mg/ml emetine in DMSO

Alternate Protocol 2: Pre‐Treatment of Cultured Cells with Initiation Inhibitors

Materials

Adherent cultured cells (see protocol 1 , Materials)
2 mg/ml harringtonine in DMSO or 50 mM lactimidomycin in DMSO

Support Protocol 1: Primary Analysis of Ribosome Profiling Data

Materials

64‐bit computer running Linux with at least 4 GB of RAM
FastX‐toolkit (http://hannonlab.cshl.edu/fastx_toolkit/index.html)
Bowtie software (http://bowtie‐bio.sourceforge.net/index.shtml)
TopHat software (http://tophat.cbcb.umd.edu/)
SAMtools software (http://samtools.sourceforge.net/)

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

Figure 4.18.1 Representative gels from intermediate product purification. (A ) Size selection of ribosome footprint fragments. The footprinting samples are derived from HeLa lysates with 5 to 15 µg input RNA. The blue bracket indicates the gel region that should be excised. (B ) Purification of ligation products. Two marker samples are shown, one of which contains only the lower and upper marker oligonucleotides, the other of which was produced by carrying forward the markers from the size selection gel through dephosphorylation and ligation. The blue bracket indicates the gel region that should be excised. The blue arrowhead indicates the unreacted linker. (C ) Purification of reverse transcription products. The blue bracket indicates the gel band that should be excised. The blue arrowhead indicates the unextended RT primer, which should be avoided. (D ) Purification of PCR products. The blue bracket indicates the ∼175‐nt product band that should be purified. The blue arrowhead indicates the ∼145‐nt background band derived from unextended RT primer that should be avoided. The blue asterisk indicates the partial duplexes resulting from re‐annealing as the PCR amplification approaches saturation. (E ) BioAnalyzer profile of a high‐quality sequencing library. A single 176‐nt peak is present. (F ) BioAnalyzer profile of a sequencing library with significant background from unextended RT primer. The background manifests as smaller DNA fragments that comprise 5% to 10% of the total DNA present in the sample; completely unextended RT primer yields a 144‐bp PCR product. The DNA in this peak will produce sequencing data, but the sequence will consist of the linker sequence with no footprint.

View Image

Videos

Literature Cited

	Anders, S. and Huber, W. 2010. Differential expression analysis for sequence count data. Genome Biol. 11:R106.
	Arava, Y., Wang, Y., Storey, J.D., Liu, C.L., Brown, P.O., and Herschlag, D. 2003. Genome‐wide analysis of mRNA translation profiles in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U.S.A. 100:3889‐3894.
	Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J., Brown, C.G., Hall, K.P., Evers, D.J., Barnes, C.L., Bignell, H.R., Boutell, J.M., Bryant, J., Carter, R.J., Keira Cheetham, R., Cox, A.J., Ellis, D.J., Flatbush, M.R., Gormley, N.A., Humphray, S.J., Irving, L.J., Karbelashvili, M.S., Kirk, S.M., Li, H., Liu, X., Maisinger, K.S., Murray, L.J., Obradovic, B., Ost, T., Parkinson, M.L., Pratt, M.R., Rasolonjatovo, I.M., Reed, M.T., Rigatti, R., Rodighiero, C., Ross, M.T., Sabot, A., Sankar, S.V., Scally, A., Schroth, G.P., Smith, M.E., Smith, V.P., Spiridou, A., Torrance, P.E., Tzonev, S.S., Vermaas, E.H., Walter, K., Wu, X., Zhang, L., Alam, M.D., Anastasi, C., Aniebo, I.C., Bailey, D.M., Bancarz, I.R., Banerjee, S., Barbour, S.G., Baybayan, P.A., Benoit, V.A., Benson, K.F., Bevis, C., Black, P.J., Boodhun, A., Brennan, J.S., Bridgham, J.A., Brown, R.C., Brown, A.A., Buermann, D.H., Bundu, A.A., Burrows, J.C., Carter, N.P., Castillo, N., Chiara, E.C.M., Chang, S., Neil Cooley, R., Crake, N.R., Dada, O.O., Diakoumakos, K.D., Dominguez‐Fernandez, B., Earnshaw, D.J., Egbujor, U.C., Elmore, D.W., Etchin, S.S., Ewan, M.R., Fedurco, M., Fraser, L.J., Fuentes Fajardo, K.V., Scott Furey, W., George, D., Gietzen, K.J., Goddard, C.P., Golda, G.S., Granieri, P.A., Green, D.E., Gustafson, D.L., Hansen, N.F., Harnish, K., Haudenschild, C.D., Heyer, N.I., Hims, M.M., Ho, J.T., Horgan, A.M., Hoschler, K., Hurwitz, S., Ivanov, D.V., Johnson, M.Q., James, T., Huw Jones, T.A., Kang, G.D., Kerelska, T.H., Kersey, A.D., Khrebtukova, I., Kindwall, A.P., Kingsbury, Z., Kokko‐Gonzales, P.I., Kumar, A., Laurent, M.A., Lawley, C.T., Lee, S.E., Lee, X., Liao, A.K., Loch, J.A., Lok, M., Luo, S., Mammen, R.M., Martin, J.W., McCauley, P.G., McNitt, P., Mehta, P., Moon, K.W., Mullens, J.W., Newington, T., Ning, Z., Ling Ng, B., Novo, S.M., O'Neill, M.J., Osborne, M.A., Osnowski, A., Ostadan, O., Paraschos, L.L., Pickering, L., Pike, A.C., Chris Pinkard, D., Pliskin, D.P., Podhasky, J., Quijano, V.J., Raczy, C., Rae, V.H., Rawlings, S.R., Chiva Rodriguez, A., Roe, P.M., Rogers, J., Rogert Bacigalupo, M.C., Romanov, N., Romieu, A., Roth, R.K., Rourke, N.J., Ruediger, S.T., Rusman, E., Sanches‐Kuiper, R.M., Schenker, M.R., Seoane, J.M., Shaw, R.J., Shiver, M.K., Short, S.W., Sizto, N.L., Sluis, J.P., Smith, M.A., Ernest Sohna Sohna, J., Spence, E.J., Stevens, K., Sutton, N., Szajkowski, L., Tregidgo, C.L., Turcatti, G., Vandevondele, S., Verhovsky, Y., Virk, S.M., Wakelin, S., Walcott, G.C., Wang, J., Worsley, G.J., Yan, J., Yau, L., Zuerlein, M., Mullikin, J.C., Hurles, M.E., McCooke, N.J., West, J.S., Oaks, F.L., Lundberg, P.L., Klenerman, D., Durbin, R., and Smith, A.J. 2008. Accurate whole human genome sequencing using reversible terminator chemistry. Nature 456:53‐59.
	Brar, G.A., Yassour, M., Friedman, N., Regev, A., Ingolia, N.T., and Weissman, J.S. 2012. High‐resolution view of the yeast meiotic program revealed by ribosome profiling. Science 335:552‐557.
	Brown, P.O. and Botstein, D. 1999. Exploring the new world of the genome with DNA microarrays. Nat. Genet. 21:33‐37.
	Bullard, J.H., Purdom, E., Hansen, K.D., and Dudoit, S. 2010. Evaluation of statistical methods for normalization and differential expression in mRNA‐Seq experiments. BMC Bioinformatics 11:94.
	del Prete, M.J., Vernal, R., Dolznig, H., Mullner, E.W., and Garcia‐Sanz, J.A. 2007. Isolation of polysome‐bound mRNA from solid tissues amenable for RT‐PCR and profiling experiments. RNA 13:414‐421.
	Dinger, M.E., Pang, K.C., Mercer, T.R., and Mattick, J.S. 2008. Differentiating protein‐coding and noncoding RNA: Challenges and ambiguities. PLoS Comput. Biol. 4:e100176.
	Fresno, M., Jimenez, A., and Vazquez, D. 1977. Inhibition of translation in eukaryotic systems by harringtonine. Eur. J. Biochem. 72:323‐330.
	Fritsch, C., Herrmann, A., Nothnagel, M., Szafranski, K., Huse, K., Schumann, F., Schreiber, S., Platzer, M., Krawczak, M., Hampe, J., and Brosch, M. 2012. Genome‐wide search for novel human uORFs and N‐terminal protein extensions using ribosomal footprinting. Genome Res. 22:2208‐2218.
	Garber, M., Grabherr, M.G., Guttman, M., and Trapnell, C. 2011. Computational methods for transcriptome annotation and quantification using RNA‐seq. Nat. Methods 8:469‐477.
	Ghaemmaghami, S., Huh, W.K., Bower, K., Howson, R.W., Belle, A., Dephoure, N., O'Shea, E.K., and Weissman, J.S. 2003. Global analysis of protein expression in yeast. Nature 425:737‐741.
	Guo, H., Ingolia, N.T., Weissman, J.S., and Bartel, D.P. 2010. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466:835‐840.
	Hafner, M., Renwick, N., Brown, M., Mihailovic, A., Holoch, D., Lin, C., Pena, J.T., Nusbaum, J.D., Morozov, P., Ludwig, J., Ojo, T., Luo, S., Schroth, G., and Tuschl, T. 2011. RNA‐ligase‐dependent biases in miRNA representation in deep‐sequenced small RNA cDNA libraries. RNA 17:1697‐1712.
	Hansen, K.D., Brenner, S.E., and Dudoit, S. 2010. Biases in Illumina transcriptome sequencing caused by random hexamer priming. Nucleic Acids Res. 38:e131.
	Heiman, M., Schaefer, A., Gong, S., Peterson, J.D., Day, M., Ramsey, K.E., Suarez‐Farinas, M., Schwarz, C., Stephan, D.A., Surmeier, D.J., Greengard, P., and Heintz, N. 2008. A translational profiling approach for the molecular characterization of CNS cell types. Cell 135:738‐748.
	Hsieh, A.C., Liu, Y., Edlind, M.P., Ingolia, N.T., Janes, M.R., Sher, A., Shi, E.Y., Stumpf, C.R., Christensen, C., Bonham, M.J., Wang, S., Ren, P., Martin, M., Jessen, K., Feldman, M.E., Weissman, J.S., Shokat, K.M., Rommel, C., and Ruggero, D. 2012. The translational landscape of mTOR signaling steers cancer initiation and metastasis. Nature 22:55‐61.
	Ingolia, N.T. 2010. Genome‐wide translational profiling by ribosome footprinting. Methods Enzymol. 470:119‐142.
	Ingolia, N.T., Ghaemmaghami, S., Newman, J.R., and Weissman, J.S. 2009. Genome‐wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324:218‐223.
	Ingolia, N.T., Lareau, L.F., and Weissman, J.S. 2011. Ribosome profiling of mouse embryonic stem cells reveals the complexity and dynamics of mammalian proteomes. Cell 147:789‐802.
	Ingolia, N.T., Brar, G.A., Rouskin, S., McGeachy, A.M., and Weissman, J.S. 2012. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome‐protected mRNA fragments. Nat. Protoc. 7:1534‐1550.
	Jelenc, P.C. 1980. Rapid purification of highly active ribosomes from Escherichia coli. Anal. Biochem. 105:369‐374.
	Kondo, T., Plaza, S., Zanet, J., Benrabah, E., Valenti, P., Hashimoto, Y., Kobayashi, S., Payre, F., and Kageyama, Y. 2010. Small peptides switch the transcriptional activity of Shavenbaby during Drosophila embryogenesis. Science 329:336‐339.
	Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. 2009. Ultrafast and memory‐efficient alignment of short DNA sequences to the human genome. Genome Biol. 10:R25.
	Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858‐862.
	Lee, S., Liu, B., Huang, S.X., Shen, B., and Qian, S.B. 2012. Global mapping of translation initiation sites in mammalian cells at single‐nucleotide resolution. Proc. Natl. Acad. Sci. U.S.A. 109:E2424‐E2432.
	Levin, J.Z., Yassour, M., Adiconis, X., Nusbaum, C., Thompson, D.A., Friedman, N., Gnirke, A., and Regev, A. 2010. Comprehensive comparative analysis of strand‐specific RNA sequencing methods. Nat. Methods 7:709‐715.
	Li, G.W., Oh, E., and Weissman, J.S. 2012. The anti‐Shine‐Dalgarno sequence drives translational pausing and codon choice in bacteria. Nature 484:538‐541.
	Li, J., Jiang, H., and Wong, W.H. 2010. Modeling non‐uniformity in short‐read rates in RNA‐Seq data. Genome Biol. 11:R50.
	Linsen, S.E., de Wit, E., Janssens, G., Heater, S., Chapman, L., Parkin, R.K., Fritz, B., Wyman, S.K., de Bruijn, E., Voest, E.E., Kuersten, S., Tewari, M., and Cuppen, E. 2009. Limitations and possibilities of small RNA digital gene expression profiling. Nat. Methods 6:474‐476.
	Lu, P., Vogel, C., Wang, R., Yao, X., and Marcotte, E.M. 2007. Absolute protein expression profiling estimates the relative contributions of transcriptional and translational regulation. Nat. Biotechnol. 25:117‐124.
	Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L., and Wold, B. 2008. Mapping and quantifying mammalian transcriptomes by RNA‐Seq. Nat. Methods 5:621‐628.
	Nagalakshmi, U., Wang, Z., Waern, K., Shou, C., Raha, D., Gerstein, M., and Snyder, M. 2008. The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320:1344‐1349.
	Oh, E., Becker, A.H., Sandikci, A., Huber, D., Chaba, R., Gloge, F., Nichols, R.J., Typas, A., Gross, C.A., Kramer, G., Weissman, J.S., and Bukau, B. 2011. Selective ribosome profiling reveals the cotranslational chaperone action of trigger factor in vivo. Cell 147:1295‐1308.
	Qian, W., Yang, J.‐R., Pearson, N.M., Maclean, C., and Zhang, J. 2012. Balanced codon usage optimizes eukaryotic translational efficiency. PLoS Genet. 8:e1002603.
	Reid, D.W. and Nicchitta, C.V. 2012. Primary role for endoplasmic reticulum‐bound ribosomes in cellular translation identified by ribosome profiling. J. Biol. Chem. 287:5518‐5527.
	Robert, F., Carrier, M., Rawe, S., Chen, S., Lowe, S., and Pelletier, J. 2009. Altering chemosensitivity by modulating translation elongation. PLoS One 4:e5428.
	Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L., and Pachter, L. 2011. Improving RNA‐Seq expression estimates by correcting for fragment bias. Genome Biol. 12:R22.
	Sampath, P., Pritchard, D.K., Pabon, L., Reinecke, H., Schwartz, S.M., Morris, D.R., and Murry, C.E. 2008. A hierarchical network controls protein translation during murine embryonic stem cell self‐renewal and differentiation. Cell Stem Cell 2:448‐460.
	Sanz, E., Yang, L., Su, T., Morris, D.R., McKnight, G.S., and Amieux, P.S. 2009. Cell‐type‐specific isolation of ribosome‐associated mRNA from complex tissues. Proc. Natl. Acad. Sci. U.S.A. 106:13939‐13944.
	Schneider‐Poetsch, T., Ju, J., Eyler, D.E., Dang, Y., Bhat, S., Merrick, W.C., Green, R., Shen, B., and Liu, J.O. 2010. Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat. Chem. Biol. 6:209‐217.
	Schwanhausser, B., Busse, D., Li, N., Dittmar, G., Schuchhardt, J., Wolf, J., Chen, W., and Selbach, M. 2011. Global quantification of mammalian gene expression control. Nature 473:337‐342.
	Sonenberg, N. and Hinnebusch, A.G. 2009. Regulation of translation initiation in eukaryotes: Mechanisms and biological targets. Cell 136:731‐745.
	Stadler, M. and Fire, A. 2011. Wobble base‐pairing slows in vivo translation elongation in metazoans. RNA 17:2063‐2073.
	Steitz, J.A. 1969. Polypeptide chain initiation: Nucleotide sequences of the three ribosomal binding sites in bacteriophage R17 RNA. Nature 224:957‐964.
	Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. 2010. Transcript assembly and quantification by RNA‐Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28:511‐515.
	Vogel, C. 2011. Translation's coming of age. Mol. Syst. Biol. 7:498.
	Wolin, S.L. and Walter, P. 1988. Ribosome pausing and stacking during translation of a eukaryotic mRNA. EMBO J. 7:3559‐3569.
	Zhuang, F., Fuchs, R.T., Sun, Z., Zheng, Y., and Robb, G.B. 2012. Structural bias in T4 RNA ligase‐mediated 3′‐adapter ligation. Nucleic Acids Res. 40:e54.
Key References
	Ingolia et al., 2009. See above.
	Describes the ribosome profiling technique and its application in budding yeast.
	Ingolia et al., 2011. See above.
	Describes the application of ribosome profiling and initiation site mapping in mammalian cells.
	Ingolia et al., 2012. See above.
	Original publication of the ribosome profiling protocol presented here.