ChIP‐chip for Genome‐Wide Analysis of Protein Binding in Mammalian Cells

互联网2013-12-31

1605

Abstract
Table of Contents
Materials
Figures
Literature Cited

Abstract

ChIP?chip combines chromatin immunoprecipitation (ChIP) with microarrays (chip) to determine protein?DNA interactions occurring in living cells. The high throughput nature of this method makes it an ideal approach for identifying transcription factor targets or chromatin modification sites along the genome. UNIT 21.9 describes a protocol for analysis of protein?DNA interactions in yeast cells. This unit introduces an alternative protocol developed for mammalian cells. Curr. Protoc. Mol. Biol. 79:21.13.1?21.13.22. © 2007 by John Wiley & Sons, Inc.

Keywords: ChIP?chip; transcription factor; chromatin modifications; genome tiling microarrays; promoter arrays

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Introduction
Basic Protocol 1: ChIP‐Chip Analysis of Protein‐DNA Binding Sites
Basic Protocol 2: Analysis of PCR Array Data
Support Protocol 1: Preparation of Annealed Linkers
Reagents and Solutions
Commentary
Literature Cited
Figures

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: ChIP‐Chip Analysis of Protein‐DNA Binding Sites

Materials

Mammalian cells (ATCC # CCL‐186)
MEM with Earle's salts (Invitrogen) supplemented with 10% FCS
PBS, pH 7.4 (Invitrogen or see recipe )
TE buffer, pH 8.0 ( appendix 22 )
5 M sodium chloride (NaCl)
0.5 M EDTA, pH 8.0
0.5 M EGTA, pH 8.0
1 M HEPES, pH 8.0
37% formaldehyde
2.5 M glycine
Lysis buffer (see recipe )
Protein extraction buffer (see recipe )
Chromatin extraction buffer (see recipe )
Glycerol
Dynabeads coupled to appropriate secondary antibodies (Invitrogen)
5 mg/ml BSA in PBS, prepared immediately before use with BSA powder (Sigma‐Aldrich)
Antibody directed against protein of interest (e.g., Upstate Biotechnology, Santa Cruz Biotech, Abcam)
Triton X‐100
10% sodium deoxycholate (DOC) in distilled water, prepared immediately before use
50× complete protease inhibitor solution, prepared immediately before use by dissolving one tablet (Roche Applied Science) in 1 ml dH₂ O
RIPA buffer (see recipe )
Elution buffer (see recipe )
20 mg/ml glycogen (Roche Applied Science)
20 mg/ml proteinase K
25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
Chloroform
75% and 100% ethanol, cold and room temperature
10 mg/ml RNase A (DNase‐free)
Qiagen QIAquick PCR purification kit (Qiagen)
3 U/µl T4 DNA polymerase and 10× buffer (New England Biolabs)
10 mg/ml BSA (acetylated, New England Biolabs)
2.5 and 20 mM dNTP mixes (containing 2.5 or 20 mM each of dATP, dCTP, dGTP, and dTTP)
3 M sodium acetate, pH 5.3
400 U/µl T4 DNA ligase and 5× buffer (New England Biolabs)
Annealed linkers (see protocol 3 )
10× ThermoPol reaction buffer (NEB)
40 mM oJW102 oligo (5′‐GCGGTGACCCGGGAGATCTGAATTC‐3′, HPLC‐purified)
5 U/µl Taq polymerase (Qiagen)
2.5 U/µl Pfu Ultra polymerase (Stratagene)
BioPrime array CGH genomic labeling system kit (Invitrogen) containing:
- Exo‐Klenow fragment
- 2.5× random primers solution
- 10× dCTP nucleotide mix
- 10× dUTP nucleotide mix
- Control DNA (salmon sperm)
- Stop buffer: 0.5 M EDTA, pH 8.0
Cy3‐dCTP and Cy5‐dCTP (GE Healthcare Biosciences)
Prehybridization solution (see recipe )
Reverse osmosis (RO) water
Cot‐1 DNA (Invitrogen)
2.2× SSC ( appendix 22 )/0.22% SDS, prepare within 1 hr of use
Hybridization buffer (see recipe )
0.1× SSC

37°C, 5% CO₂ humidified incubator
500‐cm² plates (Corning)
Cell scraper
250‐ml conical bottles
Platform rocker
15‐ and 50‐ml conical tubes
Branson 450 sonifier fitted with a microtip
Flourometer
Magnetic concentrator (Invitrogen)
65°C incubator
1.5‐ml microcentrifuge tubes
12°, 37°, 42°, and 60°C water baths
UV spectrophotometer
200‐µl PCR tubes
PCR thermal cycler
100°C heating block
Coplin jars
Cap‐locks for microcentrifuge tubes
Tabletop centrifuge (e.g., Eppendorf 5804) with microplate rotor (A‐2‐DWP)
Hybridization chambers (Corning)
Slide racks
Glass staining dish (Wheaton)
Scanner (e.g., Axon 4000B)
Scanning software (e.g., GenePix)

NOTE: Use only molecular biology grade (DNase‐free) reagents and chemicals.

Basic Protocol 2: Analysis of PCR Array Data

Materials

40 mM oJW102 (5′‐GCGGTGACCCGGGAGATCTGAATTC‐3′, HPLC‐purified)
40 mM oJW103 (5′‐GAATTCAGATC‐3′, HPLC‐purified)
1 M Tris·Cl, pH 7.9 ( appendix 22 )

1.5‐ml microcentrifuge tubes
70° and 95°C heating blocks

GO TO THE FULL PROTOCOL:

PDF or HTML at Wiley Online Library

Figures

View Image

Figure 21.13.2 Scatter plot of Cy5 (ChIP DNA) relative to Cy3 (input DNA) intensity values. Circled spots correspond to array features overlapping with ChIP‐enriched genomic loci. Reprinted with permission from Annual Review of Genomics and Human Genetics , volume 7, copyright 2006 (www.annualreviews.org).

View Image

Figure 21.13.4 M versus A plots showing the effect of applying loess normalization on NimbleGen array data. Control probes used to calculate loess normalization are highlighted in red.

View Image

Figure 21.13.5 Example of model‐based peak prediction performed by MPeak. Each bar represents the ChIP‐enrichment for a 50‐bp probe with 50‐bp spacing between probes.

View Image

Figure 21.13.6 Screenshot for five mouse ChIP‐chip tiling experiments for RNA polymerase II (RNAP) uploaded to the UCSC Genome Browser in the WIG file format. ChIP enrichment of RNAP is observed relative to three tracks of annotation: RefSeq Genes, RIKEN Cap‐Analysis of Gene Expression (CAGE) data, and CpG islands.

View Image

Videos

Literature Cited

	Bolstad, B.M., Irizarry, R.A., Astrand, M., and Speed, T.P. 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19:185‐193.
	Buck, M.J. and Lieb, J.D. 2004. ChIP‐chip: Considerations for the design, analysis, and application of genome‐wide chromatin immunoprecipitation experiments. Genomics 83:349‐360.
	Buck, M.J., Nobel, A.B., and Lieb, J.D. 2005. ChIPOTLE: A user‐friendly tool for the analysis of ChIP‐chip data. Genome Biol. 6:R97.
	Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. 1998. Cluster analysis and display of genome‐wide expression patterns. Proc. Natl. Acad. Sci. U.S.A. 95:14863‐14868.
	Gilmour, D.S. and Lis, J.T. 1985. In vivo interactions of RNA polymerase II with genes of Drosophila melanogaster. Mol. Cell. Biol. 5:2009‐2018.
	Heintzman, N.D., Stuart, R.K., Hon, G., Fu, Y., Ching, C.W., Hawkins, R.D., Barrera, L.O., Van Calcar, S., Qu, C., Ching, K.A., Wang, W., Weng, Z., Green, R.D., Crawford, G.E., and Ren, B. 2007. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat. Genet. 39:311‐318.
	Hughes, T.R., Marton, M.J., Jones, A.R., Roberts, C.J., Stoughton, R., Armour, C.D., Bennett, H.A., Coffey, E., Dai, H., He, Y.D., Kidd, M.J., King, A.M., Meyer, M.R., Slade, D., Lum, P.Y., Stepaniants, S.B., Shoemaker, D.D., Gachotte, D., Chakraburtty, K., Simon, J., Bard, M., and Friend, S.H. 2000. Functional discovery via a compendium of expression profiles. Cell 102:109‐126.
	Isogai, Y., Takada, S., Tjian, R., and Keles, S. 2007. Novel TRF1/BRF target genes revealed by genome‐wide analysis of Drosophila Pol III transcription. EMBO J. 26:79‐89.
	Iyer, V.R., Horak, C.E., Scafe, C.S., Botstein, D., Snyder. M., and Brown, P.O. 2001. Genomic binding sites of the yeast cell‐cycle transcription factors SBF and MBF. Nature 409:533‐538.
	Ji, X., Li, W., Song, J., Wei, L., and Liu, X.S. 2006. CEAS: Cis‐regulatory element annotation system. Nucl. Acids Res. 34:W551‐W554.
	Johnson, W.E., Li, W., Meyer, C.A., Gottardo, R., Carroll, J.S., Brown, M., and Liu, X.S. 2006. Model‐based analysis of tiling‐arrays for ChIP‐chip. Proc. Natl. Acad. Sci. U.S.A. 103:12457‐12462.
	Karolchik, D., Baertsch, R., Diekhans, M., Furey, T.S., Hinrichs, A., Lu, Y.T., Roskin, K.M., Schwartz, M., Sugnet, C.W., Thomas, D.J., Weber, R.J., Haussler, D., and Kent, W.J. 2003. The UCSC Genome Browser Database. Nucl. Acids Res. 31:51‐54.
	Kim, T.H., Barrera, L.O., Zheng, M., Qu, C., Singer, M.A., Richmond, T.A., Wu, Y., Green, R.D., and Ren, B. 2005. A high‐resolution map of active promoters in the human genome. Nature 436:876‐880.
	Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and Rando, O.J. 2005. Single‐nucleosome mapping of histone modifications in S. cerevisiae. PLoS Biol. 3:e328.
	Matys, V., Kel‐Margoulis, O.V., Fricke, E., Liebich, I., Land, S., Barre‐Dirrie, A., Reuter, I., Chekmenev, D., Krull, M., Hornischer, K., Voss, N., Stegmaier, P., Lewicki‐Potapov, B., Saxel, H., Kel, A.E., and Wingender, E. 2006. TRANSFAC and its module TRANSCompel: Transcriptional gene regulation in eukaryotes. Nucl. Acids Res. 34:D108‐D110.
	Orlando, V. and Paro, R. 1993. Mapping polycomb‐repressed domains in the bithorax complex using in vivo formaldehyde cross‐linked chromatin. Cell 75:1187‐1198.
	Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee, T.I., Bell, G.W., Walker, K., Rolfe, P.A., Herbolsheimer, E., Zeitlinger, J., Lewitter, F., Gifford, D.K., and Young, R.A. 2005. Genome‐wide map of nucleosome acetylation and methylation in yeast. Cell 122:517‐527.
	Qi, Y., Rolfe, A., MacIsaac, K.D., Gerber, G.K., Pokholok, D., Zeitlinger, J., Danford, T., Dowell, R.D., Fraenkel, E., Jaakkola, T.S., Young, R.A., and Gifford, D.K. 2006. High‐resolution computational models of genome binding events. Nat. Biotechnol. 24:963‐970.
	Ren, B., Robert, F., Wyrick, J.J., Aparicio, O., Jennings, E.G., Simon, I., Zeitlinger, J., Schreiber, J., Hannett, N., Kanin, E., Volkert, T.L., Wilson, C.J., Bell, S.P., and Young, R.A. 2000. Genome‐wide location and function of DNA binding proteins. Science 290:2306‐2309.
	Sandelin, A., Alkema, W., Engstrom, P., Wasserman, W.W., and Lenhard, B. 2004. JASPAR: An open‐access database for eukaryotic transcription factor binding profiles. Nucl. Acids Res. 32:D91‐D94.
	Smyth, G.K. 2005. Limma: Linear models for microarray data. In Bioinformatics and Computational Biology Solutions Using R and Bioconductor (V.C.R. Gentleman, S. Dudoit, R. Irizarry, and W. Huber, eds.) pp. 397‐420. Springer, New York.
	Smyth, G.K. and Speed, T. 2003. Normalization of cDNA microarray data. Methods 31:265‐273.
	Solomon, M.J. and Varshavsky, A. 1985. Formaldehyde‐mediated DNA‐protein cross‐linking: A probe for in vivo chromatin structures. Proc. Natl. Acad. Sci. U.S.A. 82:6470‐6474.
	Wu, Z., Irizarry, R.A., Gentleman, R., Martinez‐Murillo, F., and Spencer, F. 2004. A model based background adjustment for oligonucleotide expression arrays. In Dept. of Biostatistics Working Papers. Johns Hopkins University, Baltimore, Maryland.
	Yang, Y.H., Dudoit, S., Luu, P., Lin, D.M., Peng, V., Ngai, J., and Speed, T.P. 2002. Normalization for cDNA microarray data: A robust composite method addressing single and multiple slide systematic variation. Nucl. Acids Res. 30:e15.
	Zheng, M., Barrera, L.O., Ren, B., and Wu, Y. 2005. ChIP‐chip: Data, model, and analysis. In Proceedings of the American Statistical Association, Statistical Computing Section. American Statistical Association, Alexandria, Virginia.
Internet Resources